This page is part of the Genetic Reporting Implementation Guide (v1.1.0: STU 2 Ballot 1) based on FHIR R4. The current version which supercedes this version is 2.0.0. For a full list of available versions, see the Directory of published versions 
@prefix fhir: <http://hl7.org/fhir/> .
@prefix loinc: <http://loinc.org/rdf#> .
@prefix owl: <http://www.w3.org/2002/07/owl#> .
@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
@prefix sct: <http://snomed.info/id/> .
@prefix xsd: <http://www.w3.org/2001/XMLSchema#> .
# - resource -------------------------------------------------------------------
a fhir:Bundle;
fhir:nodeRole fhir:treeRoot;
fhir:Resource.id [ fhir:value "CG-IG-HLA-FullBundle-01"];
fhir:Bundle.type [ fhir:value "transaction"];
fhir:Bundle.entry [
fhir:index 0;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
fhir:Bundle.entry.resource <urn:uuid:13f34265-335c-4853-bc38-0815315edafa>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Patient" ] ]
], [
fhir:index 1;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
fhir:Bundle.entry.resource <urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Specimen" ] ]
], [
fhir:index 2;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ];
fhir:Bundle.entry.resource <urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Organization" ] ]
], [
fhir:index 3;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5" ];
fhir:Bundle.entry.resource <urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Organization" ] ]
], [
fhir:index 4;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ];
fhir:Bundle.entry.resource <urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "ServiceRequest" ] ]
], [
fhir:index 5;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804" ];
fhir:Bundle.entry.resource <urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ]
], [
fhir:index 6;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675" ];
fhir:Bundle.entry.resource <urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ]
], [
fhir:index 7;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621" ];
fhir:Bundle.entry.resource <urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ]
], [
fhir:index 8;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0" ];
fhir:Bundle.entry.resource <urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ]
], [
fhir:index 9;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6" ];
fhir:Bundle.entry.resource <urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ]
], [
fhir:index 10;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32" ];
fhir:Bundle.entry.resource <urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ]
], [
fhir:index 11;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228" ];
fhir:Bundle.entry.resource <urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ]
], [
fhir:index 12;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670" ];
fhir:Bundle.entry.resource <urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ]
], [
fhir:index 13;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138" ];
fhir:Bundle.entry.resource <urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ]
], [
fhir:index 14;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe" ];
fhir:Bundle.entry.resource <urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ]
], [
fhir:index 15;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309" ];
fhir:Bundle.entry.resource <urn:uuid:db69e549-6267-4777-b4b9-8813f3329309>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ]
], [
fhir:index 16;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a" ];
fhir:Bundle.entry.resource <urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ]
], [
fhir:index 17;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5" ];
fhir:Bundle.entry.resource <urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ]
], [
fhir:index 18;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70" ];
fhir:Bundle.entry.resource <urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ]
], [
fhir:index 19;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0" ];
fhir:Bundle.entry.resource <urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ]
], [
fhir:index 20;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f" ];
fhir:Bundle.entry.resource <urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ]
], [
fhir:index 21;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce" ];
fhir:Bundle.entry.resource <urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ]
], [
fhir:index 22;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9" ];
fhir:Bundle.entry.resource <urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ]
], [
fhir:index 23;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:709c5315-9403-4867-9d82-0b953836665f" ];
fhir:Bundle.entry.resource <urn:uuid:709c5315-9403-4867-9d82-0b953836665f>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ]
], [
fhir:index 24;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47" ];
fhir:Bundle.entry.resource <urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ]
], [
fhir:index 25;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208" ];
fhir:Bundle.entry.resource <urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ]
], [
fhir:index 26;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9" ];
fhir:Bundle.entry.resource <urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "DiagnosticReport" ] ]
].
<urn:uuid:13f34265-335c-4853-bc38-0815315edafa> a fhir:Patient;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <h4>Donor </h4>\n <p>name: John Storm</p>\n <p>gender: male</p>\n <p>born: 1986-12-31</p>\n </div>"
];
fhir:Patient.identifier [
fhir:index 0;
fhir:Identifier.use [ fhir:value "usual" ];
fhir:Identifier.type [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0203" ];
fhir:Coding.code [ fhir:value "DR" ] ] ];
fhir:Identifier.system [ fhir:value "urn:oid:0.0.0.0.0.0.0" ];
fhir:Identifier.value [ fhir:value "12345" ];
fhir:Identifier.period [
fhir:Period.start [ fhir:value "2012-11-10"^^xsd:date ] ];
fhir:Identifier.assigner [
fhir:Reference.display [ fhir:value "aDonorRegistry" ] ]
];
fhir:Patient.name [
fhir:index 0;
fhir:HumanName.use [ fhir:value "official" ];
fhir:HumanName.text [ fhir:value "John Storm" ];
fhir:HumanName.family [ fhir:value "Storm" ];
fhir:HumanName.given [
fhir:value "John";
fhir:index 0 ]
], [
fhir:index 1;
fhir:HumanName.use [ fhir:value "nickname" ];
fhir:HumanName.text [ fhir:value "Johnny Storm" ];
fhir:HumanName.family [ fhir:value "Storm" ];
fhir:HumanName.given [
fhir:value "Johnny";
fhir:index 0 ]
], [
fhir:index 2;
fhir:HumanName.use [ fhir:value "nickname" ];
fhir:HumanName.text [ fhir:value "The Human Torch" ]
];
fhir:Patient.gender [ fhir:value "male"];
fhir:Patient.birthDate [ fhir:value "1986-12-31"^^xsd:date].
<urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340> a fhir:Specimen;
fhir:Resource.meta [
fhir:Meta.profile [
fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/specimen";
fhir:index 0;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/specimen> ]
];
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>a buccal swab</pre>\n </div>"
];
fhir:Specimen.identifier [
fhir:index 0;
fhir:Identifier.system [ fhir:value "http://myorgsurl.com" ];
fhir:Identifier.value [ fhir:value "123" ]
];
fhir:Specimen.accessionIdentifier [
fhir:Identifier.system [ fhir:value "http://mylabsurl.com" ];
fhir:Identifier.value [ fhir:value "456" ]
];
fhir:Specimen.type [
fhir:CodeableConcept.coding [
fhir:index 0;
a sct:122555007;
fhir:Coding.system [ fhir:value "http://snomed.info/sct" ];
fhir:Coding.code [ fhir:value "122555007" ];
fhir:Coding.display [ fhir:value "Venous blood specimen" ] ]
];
fhir:Specimen.subject [
fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
fhir:Reference.type [ fhir:value "Patient" ];
fhir:Reference.display [ fhir:value "John Storm" ]
].
<urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950> a fhir:Organization;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>aTypingLab, Inc</pre>\n </div>"
];
fhir:Organization.name [ fhir:value "aTypingLab Inc"];
fhir:Organization.alias [
fhir:value "aTL";
fhir:index 0
];
fhir:Organization.telecom [
fhir:index 0;
fhir:ContactPoint.system [ fhir:value "phone" ];
fhir:ContactPoint.value [ fhir:value "1-800-555-1234" ];
fhir:ContactPoint.use [ fhir:value "work" ];
fhir:ContactPoint.rank [ fhir:value "1"^^xsd:positiveInteger ]
];
fhir:Organization.address [
fhir:index 0;
fhir:Address.use [ fhir:value "work" ];
fhir:Address.type [ fhir:value "both" ];
fhir:Address.text [ fhir:value "123 Main St, Sometown, ND 99999" ];
fhir:Address.line [
fhir:value "123 Main St";
fhir:index 0 ];
fhir:Address.city [ fhir:value "Sometown" ];
fhir:Address.state [ fhir:value "ND" ];
fhir:Address.postalCode [ fhir:value "99999" ];
fhir:Address.country [ fhir:value "USA" ]
].
<urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5> a fhir:Organization;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>aDonorRegistry</pre>\n </div>"
];
fhir:Organization.name [ fhir:value "aDonorRegistry"];
fhir:Organization.alias [
fhir:value "ADR";
fhir:index 0
];
fhir:Organization.telecom [
fhir:index 0;
fhir:ContactPoint.system [ fhir:value "phone" ];
fhir:ContactPoint.value [ fhir:value "1-800-555-6789" ];
fhir:ContactPoint.use [ fhir:value "work" ];
fhir:ContactPoint.rank [ fhir:value "1"^^xsd:positiveInteger ]
];
fhir:Organization.address [
fhir:index 0;
fhir:Address.use [ fhir:value "work" ];
fhir:Address.type [ fhir:value "both" ];
fhir:Address.text [ fhir:value "456 Main St, Anytown ND, 00000" ];
fhir:Address.line [
fhir:value "456 Main St";
fhir:index 0 ];
fhir:Address.city [ fhir:value "Anytown" ];
fhir:Address.state [ fhir:value "ND" ];
fhir:Address.postalCode [ fhir:value "00000" ];
fhir:Address.country [ fhir:value "USA" ]
].
<urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea> a fhir:ServiceRequest;
fhir:Resource.meta [
fhir:Meta.profile [
fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/servicerequest";
fhir:index 0;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/servicerequest> ]
];
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA typing request for John Storm</pre>\n </div>"
];
fhir:ServiceRequest.status [ fhir:value "completed"];
fhir:ServiceRequest.intent [ fhir:value "order"];
fhir:ServiceRequest.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:13303-3;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "13303-3" ];
fhir:Coding.display [ fhir:value "HLA-A+B+C (class I) [Type]" ] ]
];
fhir:ServiceRequest.subject [
fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
fhir:Reference.type [ fhir:value "Patient" ];
fhir:Reference.display [ fhir:value "John Storm" ]
];
fhir:ServiceRequest.authoredOn [ fhir:value "2016-11-15"^^xsd:date];
fhir:ServiceRequest.requester [
fhir:Reference.reference [ fhir:value "urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5" ];
fhir:Reference.type [ fhir:value "Organization" ];
fhir:Reference.display [ fhir:value "aDonorRegistry" ]
];
fhir:ServiceRequest.performer [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ];
fhir:Reference.type [ fhir:value "Organization" ];
fhir:Reference.display [ fhir:value "aTypingLab, Inc" ]
];
fhir:ServiceRequest.reasonCode [
fhir:index 0;
fhir:CodeableConcept.text [ fhir:value "tissue typing for donor registry" ]
].
<urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804> a fhir:MolecularSequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:01:01:01, exon 2"</pre>\n </div>"
];
fhir:MolecularSequence.type [ fhir:value "dna"];
fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:MolecularSequence.referenceSeq [
fhir:MolecularSequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00001" ] ];
fhir:CodeableConcept.text [ fhir:value "HLA-A*01:01:01:01" ] ];
fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "503"^^xsd:integer ];
fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "773"^^xsd:integer ]
];
fhir:MolecularSequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"].
<urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675> a fhir:MolecularSequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:01:01:01, exon 3"</pre>\n </div>"
];
fhir:MolecularSequence.type [ fhir:value "dna"];
fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:MolecularSequence.referenceSeq [
fhir:MolecularSequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00001" ] ];
fhir:CodeableConcept.text [ fhir:value "HLA-A*01:01:01:01" ] ];
fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "1014"^^xsd:integer ];
fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "1290"^^xsd:integer ]
];
fhir:MolecularSequence.observedSeq [ fhir:value "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"].
<urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621> a fhir:MolecularSequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:02, exon 2"</pre>\n </div>"
];
fhir:MolecularSequence.type [ fhir:value "dna"];
fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:MolecularSequence.referenceSeq [
fhir:MolecularSequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00002" ] ];
fhir:CodeableConcept.text [ fhir:value "HLA-A*01:02" ] ];
fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "503"^^xsd:integer ];
fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "773"^^xsd:integer ]
];
fhir:MolecularSequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTCCACATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"].
<urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0> a fhir:MolecularSequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:02, exon 3"</pre>\n </div>"
];
fhir:MolecularSequence.type [ fhir:value "dna"];
fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:MolecularSequence.referenceSeq [
fhir:MolecularSequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00002" ] ];
fhir:CodeableConcept.text [ fhir:value "HLA-A*01:02" ] ];
fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "1014"^^xsd:integer ];
fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "1290"^^xsd:integer ]
];
fhir:MolecularSequence.observedSeq [ fhir:value "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"].
<urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6> a fhir:Observation;
fhir:Resource.meta [
fhir:Meta.profile [
fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype";
fhir:index 0;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype> ]
];
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-A:01:01:01G</pre>\n </div>"
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.category [
fhir:index 0;
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
fhir:Coding.code [ fhir:value "laboratory" ] ]
];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:84414-2;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "84414-2" ];
fhir:Coding.display [ fhir:value "Haplotype name" ] ]
];
fhir:Observation.subject [
fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
fhir:Reference.type [ fhir:value "Patient" ];
fhir:Reference.display [ fhir:value "John Storm" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA-A*01:01:01G" ];
fhir:Coding.display [ fhir:value "HLA-A*01:01:01G" ] ]
];
fhir:Observation.method [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr" ];
fhir:Coding.code [ fhir:value "GTR000000000.0" ] ];
fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
];
fhir:Observation.specimen [
fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804" ];
fhir:Reference.type [ fhir:value "MolecularSequence" ];
fhir:Reference.display [ fhir:value "HLA-A*01:01:01:01, exon 2" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675" ];
fhir:Reference.type [ fhir:value "MolecularSequence" ];
fhir:Reference.display [ fhir:value "HLA-A*01:01:01:01, exon 3" ]
];
fhir:Observation.component [
fhir:index 0;
fhir:Observation.component.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:48018-6;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "48018-6" ];
fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ];
fhir:Observation.component.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
fhir:Coding.code [ fhir:value "HGNC:4931" ];
fhir:Coding.display [ fhir:value "HLA-A" ] ] ]
].
<urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32> a fhir:Observation;
fhir:Resource.meta [
fhir:Meta.profile [
fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype";
fhir:index 0;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype> ]
];
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-A*01:02</pre>\n </div>"
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.category [
fhir:index 0;
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
fhir:Coding.code [ fhir:value "laboratory" ] ]
];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:84414-2;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "84414-2" ];
fhir:Coding.display [ fhir:value "Haplotype name" ] ]
];
fhir:Observation.subject [
fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
fhir:Reference.type [ fhir:value "Patient" ];
fhir:Reference.display [ fhir:value "John Storm" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA-A*01:02" ];
fhir:Coding.display [ fhir:value "HLA-A*01:02" ] ]
];
fhir:Observation.method [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr" ];
fhir:Coding.code [ fhir:value "GTR000000000.0" ] ];
fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
];
fhir:Observation.specimen [
fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621" ];
fhir:Reference.type [ fhir:value "MolecularSequence" ];
fhir:Reference.display [ fhir:value "HLA-A*01:02, exon 2" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0" ];
fhir:Reference.type [ fhir:value "MolecularSequence" ];
fhir:Reference.display [ fhir:value "HLA-A*01:02, exon 3" ]
];
fhir:Observation.component [
fhir:index 0;
fhir:Observation.component.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:48018-6;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "48018-6" ];
fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ];
fhir:Observation.component.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
fhir:Coding.code [ fhir:value "HGNC:4931" ];
fhir:Coding.display [ fhir:value "HLA-A" ] ] ]
].
<urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228> a fhir:Observation;
fhir:Resource.meta [
fhir:Meta.profile [
fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype";
fhir:index 0;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype> ]
];
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-A:01:01G+HLA-A*01:02</pre>\n </div>"
];
fhir:Observation.basedOn [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ];
fhir:Reference.type [ fhir:value "ServiceRequest" ];
fhir:Reference.display [ fhir:value "Class I HLA genotyping for John Storm" ]
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.category [
fhir:index 0;
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
fhir:Coding.code [ fhir:value "laboratory" ] ]
];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:84413-4;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "84413-4" ];
fhir:Coding.display [ fhir:value "Genotype display name" ] ]
];
fhir:Observation.subject [
fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
fhir:Reference.type [ fhir:value "Patient" ];
fhir:Reference.display [ fhir:value "John Storm" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://glstring.org" ];
fhir:Coding.version [ fhir:value "1.0" ];
fhir:Coding.code [ fhir:value "hla#3.23.0#HLA-A:01:01G+HLA-A*01:02" ] ]
];
fhir:Observation.method [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr" ];
fhir:Coding.code [ fhir:value "GTR000000000.0" ] ];
fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
];
fhir:Observation.specimen [
fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6" ];
fhir:Reference.type [ fhir:value "Observation" ];
fhir:Reference.display [ fhir:value "HLA-A*01:01:01G, exons 2 and 3" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32" ];
fhir:Reference.type [ fhir:value "Observation" ];
fhir:Reference.display [ fhir:value "HLA-A*01:02, exons 2 and 3" ]
];
fhir:Observation.component [
fhir:index 0;
fhir:Observation.component.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:48018-6;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "48018-6" ];
fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ];
fhir:Observation.component.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
fhir:Coding.code [ fhir:value "HGNC:4931" ];
fhir:Coding.display [ fhir:value "HLA-A" ] ] ]
].
<urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670> a fhir:MolecularSequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*15:01:01:01, exon 2"</pre>\n </div>"
];
fhir:MolecularSequence.type [ fhir:value "dna"];
fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:MolecularSequence.referenceSeq [
fhir:MolecularSequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00162" ] ];
fhir:CodeableConcept.text [ fhir:value "HLA-B*15:01:01:01" ] ];
fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "486"^^xsd:integer ];
fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "756"^^xsd:integer ]
];
fhir:MolecularSequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"].
<urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138> a fhir:MolecularSequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*15:01:01:01, exon 3"</pre>\n </div>"
];
fhir:MolecularSequence.type [ fhir:value "dna"];
fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:MolecularSequence.referenceSeq [
fhir:MolecularSequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00162" ] ];
fhir:CodeableConcept.text [ fhir:value "HLA-B*15:01:01:01" ] ];
fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "1001"^^xsd:integer ];
fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "1277"^^xsd:integer ]
];
fhir:MolecularSequence.observedSeq [ fhir:value "GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGTGGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"].
<urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe> a fhir:MolecularSequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*57:01:01, exon 2"</pre>\n </div>"
];
fhir:MolecularSequence.type [ fhir:value "dna"];
fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:MolecularSequence.referenceSeq [
fhir:MolecularSequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00381" ] ];
fhir:CodeableConcept.text [ fhir:value "HLA-B*57:01:01" ] ];
fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "485"^^xsd:integer ];
fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "755"^^xsd:integer ]
];
fhir:MolecularSequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGAAGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG"].
<urn:uuid:db69e549-6267-4777-b4b9-8813f3329309> a fhir:MolecularSequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*57:01:01, exon 3"</pre>\n </div>"
];
fhir:MolecularSequence.type [ fhir:value "dna"];
fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:MolecularSequence.referenceSeq [
fhir:MolecularSequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00381" ] ];
fhir:CodeableConcept.text [ fhir:value "HLA-B*57:01:01" ] ];
fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "1001"^^xsd:integer ];
fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "1277"^^xsd:integer ]
];
fhir:MolecularSequence.observedSeq [ fhir:value "GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"].
<urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a> a fhir:Observation;
fhir:Resource.meta [
fhir:Meta.profile [
fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype";
fhir:index 0;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype> ]
];
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-B*15:01:01G</pre>\n </div>"
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.category [
fhir:index 0;
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
fhir:Coding.code [ fhir:value "laboratory" ] ]
];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:84414-2;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "84414-2" ];
fhir:Coding.display [ fhir:value "Haplotype name" ] ]
];
fhir:Observation.subject [
fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
fhir:Reference.type [ fhir:value "Patient" ];
fhir:Reference.display [ fhir:value "John Storm" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HGG00041" ];
fhir:Coding.display [ fhir:value "HLA-B*15:01:01G" ] ]
];
fhir:Observation.method [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr" ];
fhir:Coding.code [ fhir:value "GTR000000000.0" ] ];
fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
];
fhir:Observation.specimen [
fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670" ];
fhir:Reference.type [ fhir:value "MolecularSequence" ];
fhir:Reference.display [ fhir:value "HLA-B*15:01:01:01, exon 2" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138" ];
fhir:Reference.type [ fhir:value "MolecularSequence" ];
fhir:Reference.display [ fhir:value "HLA-B*15:01:01:01, exon 3" ]
];
fhir:Observation.component [
fhir:index 0;
fhir:Observation.component.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:48018-6;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "48018-6" ];
fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ];
fhir:Observation.component.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
fhir:Coding.code [ fhir:value "HGNC:4932" ];
fhir:Coding.display [ fhir:value "HLA-B" ] ] ]
].
<urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5> a fhir:Observation;
fhir:Resource.meta [
fhir:Meta.profile [
fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype";
fhir:index 0;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype> ]
];
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-B*57:01:01G</pre>\n </div>"
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.category [
fhir:index 0;
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
fhir:Coding.code [ fhir:value "laboratory" ] ]
];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:84414-2;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "84414-2" ];
fhir:Coding.display [ fhir:value "Haplotype name" ] ]
];
fhir:Observation.subject [
fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
fhir:Reference.type [ fhir:value "Patient" ];
fhir:Reference.display [ fhir:value "John Storm" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA-B*57:01:01G" ];
fhir:Coding.display [ fhir:value "HLA-B*57:01:01G" ] ]
];
fhir:Observation.method [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr" ];
fhir:Coding.code [ fhir:value "GTR000000000.0" ] ];
fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
];
fhir:Observation.specimen [
fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe" ];
fhir:Reference.type [ fhir:value "MolecularSequence" ];
fhir:Reference.display [ fhir:value "HLA-B*57:01:01, exon 2" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309" ];
fhir:Reference.type [ fhir:value "MolecularSequence" ];
fhir:Reference.display [ fhir:value "HLA-B*57:01:01, exon 3" ]
];
fhir:Observation.component [
fhir:index 0;
fhir:Observation.component.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:48018-6;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "48018-6" ];
fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ];
fhir:Observation.component.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
fhir:Coding.code [ fhir:value "HGNC:4932" ];
fhir:Coding.display [ fhir:value "HLA-B" ] ] ]
].
<urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70> a fhir:Observation;
fhir:Resource.meta [
fhir:Meta.profile [
fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype";
fhir:index 0;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype> ]
];
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-B*15:01:01G+HLA-B*57:01:01G</pre>\n </div>"
];
fhir:Observation.basedOn [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ];
fhir:Reference.type [ fhir:value "ServiceRequest" ];
fhir:Reference.display [ fhir:value "Class I HLA genotyping for John Storm" ]
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.category [
fhir:index 0;
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
fhir:Coding.code [ fhir:value "laboratory" ] ]
];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:84413-4;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "84413-4" ];
fhir:Coding.display [ fhir:value "Genotype display name" ] ]
];
fhir:Observation.subject [
fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
fhir:Reference.type [ fhir:value "Patient" ];
fhir:Reference.display [ fhir:value "John Storm" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://glstring.org" ];
fhir:Coding.version [ fhir:value "1.0" ];
fhir:Coding.code [ fhir:value "hla#3.23.0#HLA-B*15:01:01G+HLA-B*57:01:01G" ] ]
];
fhir:Observation.method [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr" ];
fhir:Coding.code [ fhir:value "GTR000000000.0" ] ];
fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
];
fhir:Observation.specimen [
fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a" ];
fhir:Reference.type [ fhir:value "Observation" ];
fhir:Reference.display [ fhir:value "HLA-B*15:01:01G, exons 2 and 3" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5" ];
fhir:Reference.type [ fhir:value "Observation" ];
fhir:Reference.display [ fhir:value "HLA-B*57:01:01G, exons 2 and 3" ]
];
fhir:Observation.component [
fhir:index 0;
fhir:Observation.component.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:48018-6;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "48018-6" ];
fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ];
fhir:Observation.component.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
fhir:Coding.code [ fhir:value "HGNC:4932" ];
fhir:Coding.display [ fhir:value "HLA-B" ] ] ]
].
<urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0> a fhir:MolecularSequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*01:02:01, exon 2"</pre>\n </div>"
];
fhir:MolecularSequence.type [ fhir:value "dna"];
fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:MolecularSequence.referenceSeq [
fhir:MolecularSequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00401" ] ];
fhir:CodeableConcept.text [ fhir:value "HLA-C*01:02:01" ] ];
fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "486"^^xsd:integer ];
fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "756"^^xsd:integer ]
];
fhir:MolecularSequence.observedSeq [ fhir:value "GCTCCCACTCCATGAAGTATTTCTTCACATCCGTGTCCCGGCCTGGCCGCGGAGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"].
<urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f> a fhir:MolecularSequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*01:02:01, exon 3"</pre>\n </div>"
];
fhir:MolecularSequence.type [ fhir:value "dna"];
fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:MolecularSequence.referenceSeq [
fhir:MolecularSequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00401" ] ];
fhir:CodeableConcept.text [ fhir:value "HLA-C*01:02:01" ] ];
fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "1002"^^xsd:integer ];
fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "1278"^^xsd:integer ]
];
fhir:MolecularSequence.observedSeq [ fhir:value "GGTCTCACACCCTCCAGTGGATGTGTGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"].
<urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce> a fhir:MolecularSequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*03:04:01:01, exon 2"</pre>\n </div>"
];
fhir:MolecularSequence.type [ fhir:value "dna"];
fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:MolecularSequence.referenceSeq [
fhir:MolecularSequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00413" ] ];
fhir:CodeableConcept.text [ fhir:value "HLA-C*03:04:01:01" ] ];
fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "486"^^xsd:integer ];
fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "756"^^xsd:integer ]
];
fhir:MolecularSequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"].
<urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9> a fhir:MolecularSequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*03:04:01:01, exon 3"</pre>\n </div>"
];
fhir:MolecularSequence.type [ fhir:value "dna"];
fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:MolecularSequence.referenceSeq [
fhir:MolecularSequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00413" ] ];
fhir:CodeableConcept.text [ fhir:value "HLA-C*03:04:01:01" ] ];
fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "1001"^^xsd:integer ];
fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "1277"^^xsd:integer ]
];
fhir:MolecularSequence.observedSeq [ fhir:value "GGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGG"].
<urn:uuid:709c5315-9403-4867-9d82-0b953836665f> a fhir:Observation;
fhir:Resource.meta [
fhir:Meta.profile [
fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype";
fhir:index 0;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype> ]
];
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-C*01:02:01G</pre>\n </div>"
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.category [
fhir:index 0;
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
fhir:Coding.code [ fhir:value "laboratory" ] ]
];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:84414-2;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "84414-2" ];
fhir:Coding.display [ fhir:value "Haplotype name" ] ]
];
fhir:Observation.subject [
fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
fhir:Reference.type [ fhir:value "Patient" ];
fhir:Reference.display [ fhir:value "John Storm" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA-C*01:02:01G" ];
fhir:Coding.display [ fhir:value "HLA-C*01:02:01G" ] ]
];
fhir:Observation.method [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr" ];
fhir:Coding.code [ fhir:value "GTR000000000.0" ] ];
fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
];
fhir:Observation.specimen [
fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0" ];
fhir:Reference.type [ fhir:value "MolecularSequence" ];
fhir:Reference.display [ fhir:value "HLA-C*01:02:01, exon 2" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f" ];
fhir:Reference.type [ fhir:value "MolecularSequence" ];
fhir:Reference.display [ fhir:value "HLA-C*01:02:01, exon 3" ]
];
fhir:Observation.component [
fhir:index 0;
fhir:Observation.component.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:48018-6;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "48018-6" ];
fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ];
fhir:Observation.component.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
fhir:Coding.code [ fhir:value "HGNC:4933" ];
fhir:Coding.display [ fhir:value "HLA-C" ] ] ]
].
<urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47> a fhir:Observation;
fhir:Resource.meta [
fhir:Meta.profile [
fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype";
fhir:index 0;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype> ]
];
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-C*03:04:01G</pre>\n </div>"
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.category [
fhir:index 0;
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
fhir:Coding.code [ fhir:value "laboratory" ] ]
];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:84414-2;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "84414-2" ];
fhir:Coding.display [ fhir:value "Haplotype name" ] ]
];
fhir:Observation.subject [
fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
fhir:Reference.type [ fhir:value "Patient" ];
fhir:Reference.display [ fhir:value "John Storm" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA-C*01:02:01G" ];
fhir:Coding.display [ fhir:value "HLA-C*01:02:01G" ] ]
];
fhir:Observation.method [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr" ];
fhir:Coding.code [ fhir:value "GTR000000000.0" ] ];
fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
];
fhir:Observation.specimen [
fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce" ];
fhir:Reference.type [ fhir:value "MolecularSequence" ];
fhir:Reference.display [ fhir:value "HLA-C*03:04:01:01, exon 2" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9" ];
fhir:Reference.type [ fhir:value "MolecularSequence" ];
fhir:Reference.display [ fhir:value "HLA-C*03:04:01:01, exon 3" ]
];
fhir:Observation.component [
fhir:index 0;
fhir:Observation.component.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:48018-6;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "48018-6" ];
fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ];
fhir:Observation.component.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
fhir:Coding.code [ fhir:value "HGNC:4933" ];
fhir:Coding.display [ fhir:value "HLA-C" ] ] ]
].
<urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208> a fhir:Observation;
fhir:Resource.meta [
fhir:Meta.profile [
fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype";
fhir:index 0;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype> ]
];
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-C*01:02:01G+HLA-C*03:04:01G</pre>\n </div>"
];
fhir:Observation.basedOn [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ];
fhir:Reference.type [ fhir:value "ServiceRequest" ];
fhir:Reference.display [ fhir:value "Class I HLA genotyping for John Storm" ]
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.category [
fhir:index 0;
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
fhir:Coding.code [ fhir:value "laboratory" ] ]
];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:84413-4;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "84413-4" ];
fhir:Coding.display [ fhir:value "Genotype display name" ] ]
];
fhir:Observation.subject [
fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
fhir:Reference.type [ fhir:value "Patient" ];
fhir:Reference.display [ fhir:value "John Storm" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://glstring.org" ];
fhir:Coding.version [ fhir:value "1.0" ];
fhir:Coding.code [ fhir:value "hla#3.23.0#HLA-C*01:02:01G+HLA-C*03:04:01G" ] ]
];
fhir:Observation.method [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr" ];
fhir:Coding.code [ fhir:value "GTR000000000.0" ] ];
fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
];
fhir:Observation.specimen [
fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47" ];
fhir:Reference.type [ fhir:value "Observation" ];
fhir:Reference.display [ fhir:value "HLA-C*03:04:01G, exons 2 and 3" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:709c5315-9403-4867-9d82-0b953836665f" ];
fhir:Reference.type [ fhir:value "Observation" ];
fhir:Reference.display [ fhir:value "HLA-C*01:02:01G, exons 2 and 3" ]
];
fhir:Observation.component [
fhir:index 0;
fhir:Observation.component.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:48018-6;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "48018-6" ];
fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ];
fhir:Observation.component.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
fhir:Coding.code [ fhir:value "HGNC:4933" ];
fhir:Coding.display [ fhir:value "HLA-C" ] ] ]
].
<urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9> a fhir:DiagnosticReport;
fhir:Resource.meta [
fhir:Meta.profile [
fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genomics-report";
fhir:index 0;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genomics-report> ]
];
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>\nHLA-A,-B,-C genotyping report for John Storm (MRN:12345)\n\nLOCUS ALLELE 1 ALLELE 2\nHLA-A HLA-A:01:01G HLA-A*01:02\nHLA-B HLA-B*15:01:01G HLA-B*57:01:01G\nHLA-C HLA-C*01:02:01G HLA-C*03:04:01G\n\nAllele assignments based on IMGT/HLA 3.23\nEffective date: 2015-12-15\nMethod: Sequencing of exons 2 and 3 of HLA Class I genes\nLab: aTypingLab Inc\n </pre>\n </div>"
];
fhir:DomainResource.extension [
fhir:index 0;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-allele-database" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ] ] ]
], [
fhir:index 1;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-glstring" ];
fhir:Element.extension [
fhir:index 0;
fhir:Extension.url [ fhir:value "text" ];
fhir:Extension.valueString [ fhir:value "HLA-A*01:01:01G+HLA-A*01:02^HLA-B*15:01:01G+HLA-B*57:01:01G^HLA-C*01:02:01G+HLA-C*03:04:01G" ] ], [
fhir:index 1;
fhir:Extension.url [ fhir:value "url" ];
fhir:Extension.valueUri [ fhir:value "https://gl.nmdp.org/imgt-hla/3.23.0/multilocus-unphased-genotype/ex" ] ]
];
fhir:DiagnosticReport.basedOn [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ];
fhir:Reference.type [ fhir:value "ServiceRequest" ];
fhir:Reference.display [ fhir:value "Class I HLA genotyping for John Storm" ]
];
fhir:DiagnosticReport.status [ fhir:value "final"];
fhir:DiagnosticReport.category [
fhir:index 0;
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ];
fhir:Coding.code [ fhir:value "GE" ];
fhir:Coding.display [ fhir:value "Genetics" ] ]
];
fhir:DiagnosticReport.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:81247-9;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "81247-9" ];
fhir:Coding.display [ fhir:value "Master HL7 genetic variant reporting panel" ] ], [
fhir:index 1;
fhir:Coding.system [ fhir:value "http://genenames.org/geneId" ];
fhir:Coding.code [ fhir:value "HGNC:588" ];
fhir:Coding.display [ fhir:value "Histocompatibility complex (HLA)" ] ]
];
fhir:DiagnosticReport.subject [
fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
fhir:Reference.type [ fhir:value "Patient" ];
fhir:Reference.display [ fhir:value "John Storm" ]
];
fhir:DiagnosticReport.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:DiagnosticReport.issued [ fhir:value "2016-12-15T14:15:30-06:00"^^xsd:dateTime];
fhir:DiagnosticReport.performer [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ];
fhir:Reference.type [ fhir:value "Organization" ];
fhir:Reference.display [ fhir:value "aTypingLab Inc" ]
];
fhir:DiagnosticReport.specimen [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
];
fhir:DiagnosticReport.result [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228" ];
fhir:Reference.type [ fhir:value "Observation" ];
fhir:Reference.display [ fhir:value "HLA-A: HLA-A:01:01:01G+HLA-A*01:02" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70" ];
fhir:Reference.type [ fhir:value "Observation" ];
fhir:Reference.display [ fhir:value "HLA-B: HLA-B*15:01:01G+HLA-B*57:01:01G" ]
], [
fhir:index 2;
fhir:Reference.reference [ fhir:value "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208" ];
fhir:Reference.type [ fhir:value "Observation" ];
fhir:Reference.display [ fhir:value "HLA-C: HLA-C*01:02:01G+HLA-C*03:04:01G" ]
].
# - ontology header ------------------------------------------------------------
a owl:Ontology;
owl:imports fhir:fhir.ttl.