Genomics Reporting Implementation Guide
1.1.0 - Ballot
Genomics Reporting Implementation Guide
1.1.0 - Ballot
This page is part of the Genetic Reporting Implementation Guide (v1.1.0: STU 2 Ballot 1) based on FHIR R4. The current version which supercedes this version is 2.0.0. For a full list of available versions, see the Directory of published versions 
{
"resourceType" : "Bundle",
"id" : "CG-IG-HLA-FullBundle-01",
"type" : "transaction",
"entry" : [
{
"fullUrl" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
"resource" : {
"resourceType" : "Patient",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <h4>Donor </h4>\n <p>name: John Storm</p>\n <p>gender: male</p>\n <p>born: 1986-12-31</p>\n </div>"
},
"identifier" : [
{
"use" : "usual",
"type" : {
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0203",
"code" : "DR"
}
]
},
"system" : "urn:oid:0.0.0.0.0.0.0",
"value" : "12345",
"period" : {
"start" : "2012-11-10"
},
"assigner" : {
"display" : "aDonorRegistry"
}
}
],
"name" : [
{
"use" : "official",
"text" : "John Storm",
"family" : "Storm",
"given" : [
"John"
]
},
{
"use" : "nickname",
"text" : "Johnny Storm",
"family" : "Storm",
"given" : [
"Johnny"
]
},
{
"use" : "nickname",
"text" : "The Human Torch"
}
],
"gender" : "male",
"birthDate" : "1986-12-31"
},
"request" : {
"method" : "POST",
"url" : "Patient"
}
},
{
"fullUrl" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
"resource" : {
"resourceType" : "Specimen",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/specimen"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>a buccal swab</pre>\n </div>"
},
"identifier" : [
{
"system" : "http://myorgsurl.com",
"value" : "123"
}
],
"accessionIdentifier" : {
"system" : "http://mylabsurl.com",
"value" : "456"
},
"type" : {
"coding" : [
{
"system" : "http://snomed.info/sct",
"code" : "122555007",
"display" : "Venous blood specimen"
}
]
},
"subject" : {
"reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
"type" : "Patient",
"display" : "John Storm"
}
},
"request" : {
"method" : "POST",
"url" : "Specimen"
}
},
{
"fullUrl" : "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950",
"resource" : {
"resourceType" : "Organization",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>aTypingLab, Inc</pre>\n </div>"
},
"name" : "aTypingLab Inc",
"alias" : [
"aTL"
],
"telecom" : [
{
"system" : "phone",
"value" : "1-800-555-1234",
"use" : "work",
"rank" : 1
}
],
"address" : [
{
"use" : "work",
"type" : "both",
"text" : "123 Main St, Sometown, ND 99999",
"line" : [
"123 Main St"
],
"city" : "Sometown",
"state" : "ND",
"postalCode" : "99999",
"country" : "USA"
}
]
},
"request" : {
"method" : "POST",
"url" : "Organization"
}
},
{
"fullUrl" : "urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5",
"resource" : {
"resourceType" : "Organization",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>aDonorRegistry</pre>\n </div>"
},
"name" : "aDonorRegistry",
"alias" : [
"ADR"
],
"telecom" : [
{
"system" : "phone",
"value" : "1-800-555-6789",
"use" : "work",
"rank" : 1
}
],
"address" : [
{
"use" : "work",
"type" : "both",
"text" : "456 Main St, Anytown ND, 00000",
"line" : [
"456 Main St"
],
"city" : "Anytown",
"state" : "ND",
"postalCode" : "00000",
"country" : "USA"
}
]
},
"request" : {
"method" : "POST",
"url" : "Organization"
}
},
{
"fullUrl" : "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea",
"resource" : {
"resourceType" : "ServiceRequest",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/servicerequest"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA typing request for John Storm</pre>\n </div>"
},
"status" : "completed",
"intent" : "order",
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "13303-3",
"display" : "HLA-A+B+C (class I) [Type]"
}
]
},
"subject" : {
"reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
"type" : "Patient",
"display" : "John Storm"
},
"authoredOn" : "2016-11-15",
"requester" : {
"reference" : "urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5",
"type" : "Organization",
"display" : "aDonorRegistry"
},
"performer" : [
{
"reference" : "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950",
"type" : "Organization",
"display" : "aTypingLab, Inc"
}
],
"reasonCode" : [
{
"text" : "tissue typing for donor registry"
}
]
},
"request" : {
"method" : "POST",
"url" : "ServiceRequest"
}
},
{
"fullUrl" : "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804",
"resource" : {
"resourceType" : "MolecularSequence",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:01:01:01, exon 2"</pre>\n </div>"
},
"type" : "dna",
"coordinateSystem" : 0,
"referenceSeq" : {
"referenceSeqId" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA00001"
}
],
"text" : "HLA-A*01:01:01:01"
},
"windowStart" : 503,
"windowEnd" : 773
},
"observedSeq" : "GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"
},
"request" : {
"method" : "POST",
"url" : "MolecularSequence"
}
},
{
"fullUrl" : "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675",
"resource" : {
"resourceType" : "MolecularSequence",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:01:01:01, exon 3"</pre>\n </div>"
},
"type" : "dna",
"coordinateSystem" : 0,
"referenceSeq" : {
"referenceSeqId" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA00001"
}
],
"text" : "HLA-A*01:01:01:01"
},
"windowStart" : 1014,
"windowEnd" : 1290
},
"observedSeq" : "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"
},
"request" : {
"method" : "POST",
"url" : "MolecularSequence"
}
},
{
"fullUrl" : "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621",
"resource" : {
"resourceType" : "MolecularSequence",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:02, exon 2"</pre>\n </div>"
},
"type" : "dna",
"coordinateSystem" : 0,
"referenceSeq" : {
"referenceSeqId" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA00002"
}
],
"text" : "HLA-A*01:02"
},
"windowStart" : 503,
"windowEnd" : 773
},
"observedSeq" : "GCTCCCACTCCATGAGGTATTTCTCCACATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"
},
"request" : {
"method" : "POST",
"url" : "MolecularSequence"
}
},
{
"fullUrl" : "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0",
"resource" : {
"resourceType" : "MolecularSequence",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:02, exon 3"</pre>\n </div>"
},
"type" : "dna",
"coordinateSystem" : 0,
"referenceSeq" : {
"referenceSeqId" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA00002"
}
],
"text" : "HLA-A*01:02"
},
"windowStart" : 1014,
"windowEnd" : 1290
},
"observedSeq" : "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"
},
"request" : {
"method" : "POST",
"url" : "MolecularSequence"
}
},
{
"fullUrl" : "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-A:01:01:01G</pre>\n </div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "84414-2",
"display" : "Haplotype name"
}
]
},
"subject" : {
"reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
"type" : "Patient",
"display" : "John Storm"
},
"effectiveDateTime" : "2016-12-15",
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA-A*01:01:01G",
"display" : "HLA-A*01:01:01G"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/gtr",
"code" : "GTR000000000.0"
}
],
"text" : "NGS based Class I HLA-A, -B, -C genotyping"
},
"specimen" : {
"reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
"display" : "buccal swab from John Storm"
},
"derivedFrom" : [
{
"reference" : "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804",
"type" : "MolecularSequence",
"display" : "HLA-A*01:01:01:01, exon 2"
},
{
"reference" : "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675",
"type" : "MolecularSequence",
"display" : "HLA-A*01:01:01:01, exon 3"
}
],
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:4931",
"display" : "HLA-A"
}
]
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-A*01:02</pre>\n </div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "84414-2",
"display" : "Haplotype name"
}
]
},
"subject" : {
"reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
"type" : "Patient",
"display" : "John Storm"
},
"effectiveDateTime" : "2016-12-15",
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA-A*01:02",
"display" : "HLA-A*01:02"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/gtr",
"code" : "GTR000000000.0"
}
],
"text" : "NGS based Class I HLA-A, -B, -C genotyping"
},
"specimen" : {
"reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
"display" : "buccal swab from John Storm"
},
"derivedFrom" : [
{
"reference" : "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621",
"type" : "MolecularSequence",
"display" : "HLA-A*01:02, exon 2"
},
{
"reference" : "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0",
"type" : "MolecularSequence",
"display" : "HLA-A*01:02, exon 3"
}
],
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:4931",
"display" : "HLA-A"
}
]
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-A:01:01G+HLA-A*01:02</pre>\n </div>"
},
"basedOn" : [
{
"reference" : "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea",
"type" : "ServiceRequest",
"display" : "Class I HLA genotyping for John Storm"
}
],
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "84413-4",
"display" : "Genotype display name"
}
]
},
"subject" : {
"reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
"type" : "Patient",
"display" : "John Storm"
},
"effectiveDateTime" : "2016-12-15",
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://glstring.org",
"version" : "1.0",
"code" : "hla#3.23.0#HLA-A:01:01G+HLA-A*01:02"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/gtr",
"code" : "GTR000000000.0"
}
],
"text" : "NGS based Class I HLA-A, -B, -C genotyping"
},
"specimen" : {
"reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
"display" : "buccal swab from John Storm"
},
"derivedFrom" : [
{
"reference" : "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6",
"type" : "Observation",
"display" : "HLA-A*01:01:01G, exons 2 and 3"
},
{
"reference" : "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32",
"type" : "Observation",
"display" : "HLA-A*01:02, exons 2 and 3"
}
],
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:4931",
"display" : "HLA-A"
}
]
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670",
"resource" : {
"resourceType" : "MolecularSequence",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*15:01:01:01, exon 2"</pre>\n </div>"
},
"type" : "dna",
"coordinateSystem" : 0,
"referenceSeq" : {
"referenceSeqId" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA00162"
}
],
"text" : "HLA-B*15:01:01:01"
},
"windowStart" : 486,
"windowEnd" : 756
},
"observedSeq" : "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"
},
"request" : {
"method" : "POST",
"url" : "MolecularSequence"
}
},
{
"fullUrl" : "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138",
"resource" : {
"resourceType" : "MolecularSequence",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*15:01:01:01, exon 3"</pre>\n </div>"
},
"type" : "dna",
"coordinateSystem" : 0,
"referenceSeq" : {
"referenceSeqId" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA00162"
}
],
"text" : "HLA-B*15:01:01:01"
},
"windowStart" : 1001,
"windowEnd" : 1277
},
"observedSeq" : "GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGTGGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"
},
"request" : {
"method" : "POST",
"url" : "MolecularSequence"
}
},
{
"fullUrl" : "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe",
"resource" : {
"resourceType" : "MolecularSequence",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*57:01:01, exon 2"</pre>\n </div>"
},
"type" : "dna",
"coordinateSystem" : 0,
"referenceSeq" : {
"referenceSeqId" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA00381"
}
],
"text" : "HLA-B*57:01:01"
},
"windowStart" : 485,
"windowEnd" : 755
},
"observedSeq" : "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGAAGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG"
},
"request" : {
"method" : "POST",
"url" : "MolecularSequence"
}
},
{
"fullUrl" : "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309",
"resource" : {
"resourceType" : "MolecularSequence",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*57:01:01, exon 3"</pre>\n </div>"
},
"type" : "dna",
"coordinateSystem" : 0,
"referenceSeq" : {
"referenceSeqId" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA00381"
}
],
"text" : "HLA-B*57:01:01"
},
"windowStart" : 1001,
"windowEnd" : 1277
},
"observedSeq" : "GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"
},
"request" : {
"method" : "POST",
"url" : "MolecularSequence"
}
},
{
"fullUrl" : "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-B*15:01:01G</pre>\n </div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "84414-2",
"display" : "Haplotype name"
}
]
},
"subject" : {
"reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
"type" : "Patient",
"display" : "John Storm"
},
"effectiveDateTime" : "2016-12-15",
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HGG00041",
"display" : "HLA-B*15:01:01G"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/gtr",
"code" : "GTR000000000.0"
}
],
"text" : "NGS based Class I HLA-A, -B, -C genotyping"
},
"specimen" : {
"reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
"display" : "buccal swab from John Storm"
},
"derivedFrom" : [
{
"reference" : "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670",
"type" : "MolecularSequence",
"display" : "HLA-B*15:01:01:01, exon 2"
},
{
"reference" : "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138",
"type" : "MolecularSequence",
"display" : "HLA-B*15:01:01:01, exon 3"
}
],
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:4932",
"display" : "HLA-B"
}
]
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-B*57:01:01G</pre>\n </div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "84414-2",
"display" : "Haplotype name"
}
]
},
"subject" : {
"reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
"type" : "Patient",
"display" : "John Storm"
},
"effectiveDateTime" : "2016-12-15",
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA-B*57:01:01G",
"display" : "HLA-B*57:01:01G"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/gtr",
"code" : "GTR000000000.0"
}
],
"text" : "NGS based Class I HLA-A, -B, -C genotyping"
},
"specimen" : {
"reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
"display" : "buccal swab from John Storm"
},
"derivedFrom" : [
{
"reference" : "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe",
"type" : "MolecularSequence",
"display" : "HLA-B*57:01:01, exon 2"
},
{
"reference" : "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309",
"type" : "MolecularSequence",
"display" : "HLA-B*57:01:01, exon 3"
}
],
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:4932",
"display" : "HLA-B"
}
]
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-B*15:01:01G+HLA-B*57:01:01G</pre>\n </div>"
},
"basedOn" : [
{
"reference" : "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea",
"type" : "ServiceRequest",
"display" : "Class I HLA genotyping for John Storm"
}
],
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "84413-4",
"display" : "Genotype display name"
}
]
},
"subject" : {
"reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
"type" : "Patient",
"display" : "John Storm"
},
"effectiveDateTime" : "2016-12-15",
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://glstring.org",
"version" : "1.0",
"code" : "hla#3.23.0#HLA-B*15:01:01G+HLA-B*57:01:01G"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/gtr",
"code" : "GTR000000000.0"
}
],
"text" : "NGS based Class I HLA-A, -B, -C genotyping"
},
"specimen" : {
"reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
"display" : "buccal swab from John Storm"
},
"derivedFrom" : [
{
"reference" : "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a",
"type" : "Observation",
"display" : "HLA-B*15:01:01G, exons 2 and 3"
},
{
"reference" : "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5",
"type" : "Observation",
"display" : "HLA-B*57:01:01G, exons 2 and 3"
}
],
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:4932",
"display" : "HLA-B"
}
]
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0",
"resource" : {
"resourceType" : "MolecularSequence",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*01:02:01, exon 2"</pre>\n </div>"
},
"type" : "dna",
"coordinateSystem" : 0,
"referenceSeq" : {
"referenceSeqId" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA00401"
}
],
"text" : "HLA-C*01:02:01"
},
"windowStart" : 486,
"windowEnd" : 756
},
"observedSeq" : "GCTCCCACTCCATGAAGTATTTCTTCACATCCGTGTCCCGGCCTGGCCGCGGAGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"
},
"request" : {
"method" : "POST",
"url" : "MolecularSequence"
}
},
{
"fullUrl" : "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f",
"resource" : {
"resourceType" : "MolecularSequence",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*01:02:01, exon 3"</pre>\n </div>"
},
"type" : "dna",
"coordinateSystem" : 0,
"referenceSeq" : {
"referenceSeqId" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA00401"
}
],
"text" : "HLA-C*01:02:01"
},
"windowStart" : 1002,
"windowEnd" : 1278
},
"observedSeq" : "GGTCTCACACCCTCCAGTGGATGTGTGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"
},
"request" : {
"method" : "POST",
"url" : "MolecularSequence"
}
},
{
"fullUrl" : "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce",
"resource" : {
"resourceType" : "MolecularSequence",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*03:04:01:01, exon 2"</pre>\n </div>"
},
"type" : "dna",
"coordinateSystem" : 0,
"referenceSeq" : {
"referenceSeqId" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA00413"
}
],
"text" : "HLA-C*03:04:01:01"
},
"windowStart" : 486,
"windowEnd" : 756
},
"observedSeq" : "GCTCCCACTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"
},
"request" : {
"method" : "POST",
"url" : "MolecularSequence"
}
},
{
"fullUrl" : "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9",
"resource" : {
"resourceType" : "MolecularSequence",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*03:04:01:01, exon 3"</pre>\n </div>"
},
"type" : "dna",
"coordinateSystem" : 0,
"referenceSeq" : {
"referenceSeqId" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA00413"
}
],
"text" : "HLA-C*03:04:01:01"
},
"windowStart" : 1001,
"windowEnd" : 1277
},
"observedSeq" : "GGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGG"
},
"request" : {
"method" : "POST",
"url" : "MolecularSequence"
}
},
{
"fullUrl" : "urn:uuid:709c5315-9403-4867-9d82-0b953836665f",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-C*01:02:01G</pre>\n </div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "84414-2",
"display" : "Haplotype name"
}
]
},
"subject" : {
"reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
"type" : "Patient",
"display" : "John Storm"
},
"effectiveDateTime" : "2016-12-15",
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA-C*01:02:01G",
"display" : "HLA-C*01:02:01G"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/gtr",
"code" : "GTR000000000.0"
}
],
"text" : "NGS based Class I HLA-A, -B, -C genotyping"
},
"specimen" : {
"reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
"display" : "buccal swab from John Storm"
},
"derivedFrom" : [
{
"reference" : "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0",
"type" : "MolecularSequence",
"display" : "HLA-C*01:02:01, exon 2"
},
{
"reference" : "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f",
"type" : "MolecularSequence",
"display" : "HLA-C*01:02:01, exon 3"
}
],
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:4933",
"display" : "HLA-C"
}
]
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-C*03:04:01G</pre>\n </div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "84414-2",
"display" : "Haplotype name"
}
]
},
"subject" : {
"reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
"type" : "Patient",
"display" : "John Storm"
},
"effectiveDateTime" : "2016-12-15",
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23",
"code" : "HLA-C*01:02:01G",
"display" : "HLA-C*01:02:01G"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/gtr",
"code" : "GTR000000000.0"
}
],
"text" : "NGS based Class I HLA-A, -B, -C genotyping"
},
"specimen" : {
"reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
"display" : "buccal swab from John Storm"
},
"derivedFrom" : [
{
"reference" : "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce",
"type" : "MolecularSequence",
"display" : "HLA-C*03:04:01:01, exon 2"
},
{
"reference" : "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9",
"type" : "MolecularSequence",
"display" : "HLA-C*03:04:01:01, exon 3"
}
],
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:4933",
"display" : "HLA-C"
}
]
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-C*01:02:01G+HLA-C*03:04:01G</pre>\n </div>"
},
"basedOn" : [
{
"reference" : "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea",
"type" : "ServiceRequest",
"display" : "Class I HLA genotyping for John Storm"
}
],
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "84413-4",
"display" : "Genotype display name"
}
]
},
"subject" : {
"reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
"type" : "Patient",
"display" : "John Storm"
},
"effectiveDateTime" : "2016-12-15",
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://glstring.org",
"version" : "1.0",
"code" : "hla#3.23.0#HLA-C*01:02:01G+HLA-C*03:04:01G"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/gtr",
"code" : "GTR000000000.0"
}
],
"text" : "NGS based Class I HLA-A, -B, -C genotyping"
},
"specimen" : {
"reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
"display" : "buccal swab from John Storm"
},
"derivedFrom" : [
{
"reference" : "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47",
"type" : "Observation",
"display" : "HLA-C*03:04:01G, exons 2 and 3"
},
{
"reference" : "urn:uuid:709c5315-9403-4867-9d82-0b953836665f",
"type" : "Observation",
"display" : "HLA-C*01:02:01G, exons 2 and 3"
}
],
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:4933",
"display" : "HLA-C"
}
]
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9",
"resource" : {
"resourceType" : "DiagnosticReport",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genomics-report"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>\nHLA-A,-B,-C genotyping report for John Storm (MRN:12345)\n\nLOCUS ALLELE 1 ALLELE 2\nHLA-A HLA-A:01:01G HLA-A*01:02\nHLA-B HLA-B*15:01:01G HLA-B*57:01:01G\nHLA-C HLA-C*01:02:01G HLA-C*03:04:01G\n\nAllele assignments based on IMGT/HLA 3.23\nEffective date: 2015-12-15\nMethod: Sequencing of exons 2 and 3 of HLA Class I genes\nLab: aTypingLab Inc\n </pre>\n </div>"
},
"extension" : [
{
"url" : "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-allele-database",
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
"version" : "3.23"
}
]
}
},
{
"url" : "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-glstring",
"extension" : [
{
"url" : "text",
"valueString" : "HLA-A*01:01:01G+HLA-A*01:02^HLA-B*15:01:01G+HLA-B*57:01:01G^HLA-C*01:02:01G+HLA-C*03:04:01G"
},
{
"url" : "url",
"valueUri" : "https://gl.nmdp.org/imgt-hla/3.23.0/multilocus-unphased-genotype/ex"
}
]
}
],
"basedOn" : [
{
"reference" : "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea",
"type" : "ServiceRequest",
"display" : "Class I HLA genotyping for John Storm"
}
],
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE",
"display" : "Genetics"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81247-9",
"display" : "Master HL7 genetic variant reporting panel"
},
{
"system" : "http://genenames.org/geneId",
"code" : "HGNC:588",
"display" : "Histocompatibility complex (HLA)"
}
]
},
"subject" : {
"reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
"type" : "Patient",
"display" : "John Storm"
},
"effectiveDateTime" : "2016-12-15",
"issued" : "2016-12-15T14:15:30-06:00",
"performer" : [
{
"reference" : "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950",
"type" : "Organization",
"display" : "aTypingLab Inc"
}
],
"specimen" : [
{
"reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
"display" : "buccal swab from John Storm"
}
],
"result" : [
{
"reference" : "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228",
"type" : "Observation",
"display" : "HLA-A: HLA-A:01:01:01G+HLA-A*01:02"
},
{
"reference" : "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70",
"type" : "Observation",
"display" : "HLA-B: HLA-B*15:01:01G+HLA-B*57:01:01G"
},
{
"reference" : "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208",
"type" : "Observation",
"display" : "HLA-C: HLA-C*01:02:01G+HLA-C*03:04:01G"
}
]
},
"request" : {
"method" : "POST",
"url" : "DiagnosticReport"
}
}
]
}
IG © 2019+ HL7 International Clinical Genomics Work Group. Package hl7.fhir.uv.genomics-reporting#1.1.0 based on FHIR 4.0.1. Generated 2021-04-13
Links: Table of Contents |
QA Report
| Version History |
Search |
|
Propose a change