Genomics Reporting Implementation Guide (STU1)

This page is part of the Genetic Reporting Implementation Guide (v1.0.0: STU 1) based on FHIR R4. The current version which supercedes this version is 2.0.0. For a full list of available versions, see the Directory of published versions

Example - Multiple Oncology Variant Report Example - TTL Representation

(back to narrative)

Raw ttl

@prefix fhir: <http://hl7.org/fhir/> .
@prefix loinc: <http://loinc.org/rdf#> .
@prefix owl: <http://www.w3.org/2002/07/owl#> .
@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
@prefix xsd: <http://www.w3.org/2001/XMLSchema#> .

# - resource -------------------------------------------------------------------

 a fhir:Bundle;
  fhir:nodeRole fhir:treeRoot;
  fhir:Resource.id [ fhir:value "oncology-report-example"];
  fhir:Bundle.type [ fhir:value "transaction"];
  fhir:Bundle.entry [
     fhir:index 0;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ];
     fhir:Bundle.entry.resource <urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Organization" ];
       fhir:Bundle.entry.request.ifNoneExist [ fhir:value "identifier=http://molit.eu/fhir/genomics/NamingSystem/organization|CEGAT" ]     ]
  ], [
     fhir:index 1;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ];
     fhir:Bundle.entry.resource <urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Patient" ];
       fhir:Bundle.entry.request.ifNoneExist [ fhir:value "identifier=http://molit.eu/fhir/genomics/NamingSystem/cegat/patID|11111" ]     ]
  ], [
     fhir:index 2;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516" ];
     fhir:Bundle.entry.resource <urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Specimen" ];
       fhir:Bundle.entry.request.ifNoneExist [ fhir:value "identifier=http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID|UNKNOWN" ]     ]
  ], [
     fhir:index 3;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae" ];
     fhir:Bundle.entry.resource <urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 4;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00" ];
     fhir:Bundle.entry.resource <urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 5;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5" ];
     fhir:Bundle.entry.resource <urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 6;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358" ];
     fhir:Bundle.entry.resource <urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 7;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:58828523-8893-45fc-973b-16290366c5e5" ];
     fhir:Bundle.entry.resource <urn:uuid:58828523-8893-45fc-973b-16290366c5e5>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 8;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2" ];
     fhir:Bundle.entry.resource <urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 9;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1" ];
     fhir:Bundle.entry.resource <urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 10;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf" ];
     fhir:Bundle.entry.resource <urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 11;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:c3587931-242f-4129-93f9-be24500c8f29" ];
     fhir:Bundle.entry.resource <urn:uuid:c3587931-242f-4129-93f9-be24500c8f29>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 12;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6" ];
     fhir:Bundle.entry.resource <urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 13;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2" ];
     fhir:Bundle.entry.resource <urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 14;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca" ];
     fhir:Bundle.entry.resource <urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 15;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:6a80003f-822d-489e-8286-1f1dcba56dfa" ];
     fhir:Bundle.entry.resource <urn:uuid:6a80003f-822d-489e-8286-1f1dcba56dfa>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "DiagnosticReport" ]     ]
  ].

<urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17> a fhir:Organization;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>identifier</b>: CEGAT</p><p><b>name</b>: CEGAT</p></div>"
  ];
  fhir:Organization.identifier [
     fhir:index 0;
     fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/organization" ];
     fhir:Identifier.value [ fhir:value "CEGAT" ]
  ];
  fhir:Organization.name [ fhir:value "CEGAT"].

<urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648> a fhir:Patient;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>identifier</b>: 11111</p></div>"
  ];
  fhir:Patient.identifier [
     fhir:index 0;
     fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/cegat/patID" ];
     fhir:Identifier.value [ fhir:value "11111" ]
  ].

<urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516> a fhir:Specimen;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>identifier</b>: UNKNOWN</p><p><b>type</b>: Tumor <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/v2-0487 code 'TUMOR' = 'Tumor', given as 'Tumor'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><h3>Collections</h3><table class=\"grid\"><tr><td>-</td><td><b>Method</b></td><td><b>BodySite</b></td></tr><tr><td>*</td><td>Biopsie <span style=\"background: LightGoldenRodYellow\">(Details : {http://molit.eu/fhir/IG_TODO code 'Biopsy' = 'Biopsy', given as 'Biopsie'})</span></td><td>C16.0 <span style=\"background: LightGoldenRodYellow\">(Details : {http://example.org/fhir/sid/icd-9-cm code 'C16.0' = 'C16.0)</span></td></tr></table></div>"
  ];
  fhir:Specimen.identifier [
     fhir:index 0;
     fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID" ];
     fhir:Identifier.value [ fhir:value "UNKNOWN" ]
  ];
  fhir:Specimen.type [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0487" ];
       fhir:Coding.code [ fhir:value "TUMOR" ];
       fhir:Coding.display [ fhir:value "Tumor" ]     ]
  ];
  fhir:Specimen.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ]
  ];
  fhir:Specimen.collection [
     fhir:Specimen.collection.method [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://molit.eu/fhir/IG_TODO" ];
         fhir:Coding.code [ fhir:value "Biopsy" ];
         fhir:Coding.display [ fhir:value "Biopsie" ]       ]     ];
     fhir:Specimen.collection.bodySite [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://example.org/fhir/sid/icd-9-cm" ];
         fhir:Coding.code [ fhir:value "C16.0" ]       ]     ]
  ].

<urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: PIK3CA <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:8975' = 'HGNC:8975', given as 'PIK3CA'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.3140A&gt;G <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.3140A&gt;G' = 'c.3140A&gt;G', given as 'c.3140A&gt;G'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.H1047R <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.H1047R' = 'p.H1047R', given as 'p.H1047R'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_006218.3 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_006218.3' = 'NM_006218.3', given as 'NM_006218.3'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: A</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.2188 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 64.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:69548-6;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "69548-6" ];
       fhir:Coding.display [ fhir:value "Genetic variant assessment" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ]
  ];
  fhir:Observation.performer [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ]
  ];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA9633-4;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA9633-4" ];
       fhir:Coding.display [ fhir:value "Present" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA26398-0;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA26398-0" ];
       fhir:Coding.display [ fhir:value "Sequencing" ]     ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.identifier [
       fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID" ];
       fhir:Identifier.value [ fhir:value "UNKNOWN" ]     ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48002-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48002-0" ];
         fhir:Coding.display [ fhir:value "Genomic source class" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6684-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6684-0" ];
         fhir:Coding.display [ fhir:value "Somatic" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene studied [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
         fhir:Coding.code [ fhir:value "HGNC:8975" ];
         fhir:Coding.display [ fhir:value "PIK3CA" ]       ]     ]
  ], [
     fhir:index 2;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:62374-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "62374-4" ];
         fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA14029-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA14029-5" ];
         fhir:Coding.display [ fhir:value "GRCh37" ]       ]     ]
  ], [
     fhir:index 3;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48004-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48004-6" ];
         fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "c.3140A>G" ];
         fhir:Coding.display [ fhir:value "c.3140A>G" ]       ]     ]
  ], [
     fhir:index 4;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48019-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48019-4" ];
         fhir:Coding.display [ fhir:value "DNA change type" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:1000002" ];
         fhir:Coding.display [ fhir:value "substitution" ]       ]     ]
  ], [
     fhir:index 5;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48005-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48005-3" ];
         fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "p.H1047R" ];
         fhir:Coding.display [ fhir:value "p.H1047R" ]       ]     ]
  ], [
     fhir:index 6;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes" ];
         fhir:Coding.code [ fhir:value "functional-annotation" ];
         fhir:Coding.display [ fhir:value "functional-annotation" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:0001583" ];
         fhir:Coding.display [ fhir:value "missense_variant" ]       ]     ]
  ], [
     fhir:index 7;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:51958-7;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "51958-7" ];
         fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ];
         fhir:Coding.code [ fhir:value "NM_006218.3" ];
         fhir:Coding.display [ fhir:value "NM_006218.3" ]       ]     ]
  ], [
     fhir:index 8;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:69547-8;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "69547-8" ];
         fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ]       ]     ];
     fhir:Observation.component.valueString [ fhir:value "A" ]
  ], [
     fhir:index 9;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81258-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81258-6" ];
         fhir:Coding.display [ fhir:value "Sample VAF" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "0.2188"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "1" ]     ]
  ], [
     fhir:index 10;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:82121-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "82121-5" ];
         fhir:Coding.display [ fhir:value "Allelic read depth" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "64.0"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "reads per base pair" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "{reads}/{base}" ]     ]
  ].

<urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: NRAS <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:7989' = 'HGNC:7989', given as 'NRAS'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.34G&gt;T <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.34G&gt;T' = 'c.34G&gt;T', given as 'c.34G&gt;T'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.G12C <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.G12C' = 'p.G12C', given as 'p.G12C'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_002524.4 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_002524.4' = 'NM_002524.4', given as 'NM_002524.4'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.1793 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 145.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:69548-6;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "69548-6" ];
       fhir:Coding.display [ fhir:value "Genetic variant assessment" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ]
  ];
  fhir:Observation.performer [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ]
  ];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA9633-4;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA9633-4" ];
       fhir:Coding.display [ fhir:value "Present" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA26398-0;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA26398-0" ];
       fhir:Coding.display [ fhir:value "Sequencing" ]     ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.identifier [
       fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID" ];
       fhir:Identifier.value [ fhir:value "UNKNOWN" ]     ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48002-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48002-0" ];
         fhir:Coding.display [ fhir:value "Genomic source class" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6684-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6684-0" ];
         fhir:Coding.display [ fhir:value "Somatic" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene studied [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
         fhir:Coding.code [ fhir:value "HGNC:7989" ];
         fhir:Coding.display [ fhir:value "NRAS" ]       ]     ]
  ], [
     fhir:index 2;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:62374-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "62374-4" ];
         fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA14029-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA14029-5" ];
         fhir:Coding.display [ fhir:value "GRCh37" ]       ]     ]
  ], [
     fhir:index 3;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48004-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48004-6" ];
         fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "c.34G>T" ];
         fhir:Coding.display [ fhir:value "c.34G>T" ]       ]     ]
  ], [
     fhir:index 4;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48019-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48019-4" ];
         fhir:Coding.display [ fhir:value "DNA change type" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:1000002" ];
         fhir:Coding.display [ fhir:value "substitution" ]       ]     ]
  ], [
     fhir:index 5;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48005-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48005-3" ];
         fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "p.G12C" ];
         fhir:Coding.display [ fhir:value "p.G12C" ]       ]     ]
  ], [
     fhir:index 6;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes" ];
         fhir:Coding.code [ fhir:value "functional-annotation" ];
         fhir:Coding.display [ fhir:value "functional-annotation" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:0001583" ];
         fhir:Coding.display [ fhir:value "missense_variant" ]       ]     ]
  ], [
     fhir:index 7;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:51958-7;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "51958-7" ];
         fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ];
         fhir:Coding.code [ fhir:value "NM_002524.4" ];
         fhir:Coding.display [ fhir:value "NM_002524.4" ]       ]     ]
  ], [
     fhir:index 8;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:69547-8;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "69547-8" ];
         fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ]       ]     ];
     fhir:Observation.component.valueString [ fhir:value "C" ]
  ], [
     fhir:index 9;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81258-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81258-6" ];
         fhir:Coding.display [ fhir:value "Sample VAF" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "0.1793"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "1" ]     ]
  ], [
     fhir:index 10;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:82121-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "82121-5" ];
         fhir:Coding.display [ fhir:value "Allelic read depth" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "145.0"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "reads per base pair" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "{reads}/{base}" ]     ]
  ].

<urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: FBXW7 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:16712' = 'HGNC:16712', given as 'FBXW7'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.1394G&gt;A <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.1394G&gt;A' = 'c.1394G&gt;A', given as 'c.1394G&gt;A'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.R465H <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.R465H' = 'p.R465H', given as 'p.R465H'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_001349798.2 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_001349798.2' = 'NM_001349798.2', given as 'NM_001349798.2'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.1053 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 57.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:69548-6;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "69548-6" ];
       fhir:Coding.display [ fhir:value "Genetic variant assessment" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ]
  ];
  fhir:Observation.performer [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ]
  ];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA9633-4;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA9633-4" ];
       fhir:Coding.display [ fhir:value "Present" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA26398-0;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA26398-0" ];
       fhir:Coding.display [ fhir:value "Sequencing" ]     ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.identifier [
       fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID" ];
       fhir:Identifier.value [ fhir:value "UNKNOWN" ]     ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48002-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48002-0" ];
         fhir:Coding.display [ fhir:value "Genomic source class" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6684-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6684-0" ];
         fhir:Coding.display [ fhir:value "Somatic" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene studied [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
         fhir:Coding.code [ fhir:value "HGNC:16712" ];
         fhir:Coding.display [ fhir:value "FBXW7" ]       ]     ]
  ], [
     fhir:index 2;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:62374-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "62374-4" ];
         fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA14029-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA14029-5" ];
         fhir:Coding.display [ fhir:value "GRCh37" ]       ]     ]
  ], [
     fhir:index 3;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48004-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48004-6" ];
         fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "c.1394G>A" ];
         fhir:Coding.display [ fhir:value "c.1394G>A" ]       ]     ]
  ], [
     fhir:index 4;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48019-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48019-4" ];
         fhir:Coding.display [ fhir:value "DNA change type" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:1000002" ];
         fhir:Coding.display [ fhir:value "substitution" ]       ]     ]
  ], [
     fhir:index 5;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48005-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48005-3" ];
         fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "p.R465H" ];
         fhir:Coding.display [ fhir:value "p.R465H" ]       ]     ]
  ], [
     fhir:index 6;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes" ];
         fhir:Coding.code [ fhir:value "functional-annotation" ];
         fhir:Coding.display [ fhir:value "functional-annotation" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:0001583" ];
         fhir:Coding.display [ fhir:value "missense_variant" ]       ]     ]
  ], [
     fhir:index 7;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:51958-7;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "51958-7" ];
         fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ];
         fhir:Coding.code [ fhir:value "NM_001349798.2" ];
         fhir:Coding.display [ fhir:value "NM_001349798.2" ]       ]     ]
  ], [
     fhir:index 8;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:69547-8;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "69547-8" ];
         fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ]       ]     ];
     fhir:Observation.component.valueString [ fhir:value "C" ]
  ], [
     fhir:index 9;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81258-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81258-6" ];
         fhir:Coding.display [ fhir:value "Sample VAF" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "0.1053"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "1" ]     ]
  ], [
     fhir:index 10;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:82121-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "82121-5" ];
         fhir:Coding.display [ fhir:value "Allelic read depth" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "57.0"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "reads per base pair" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "{reads}/{base}" ]     ]
  ].

<urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: KMT2D <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:7133' = 'HGNC:7133', given as 'KMT2D'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.7900_7901delCA <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.7900_7901delCA' = 'c.7900_7901delCA', given as 'c.7900_7901delCA'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: deletion <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0000159' = 'SO:0000159', given as 'deletion'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.Q2634Afs*20 <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.Q2634Afs*20' = 'p.Q2634Afs*20', given as 'p.Q2634Afs*20'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: frameshift <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0000865' = 'SO:0000865', given as 'frameshift'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_003482.3 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_003482.3' = 'NM_003482.3', given as 'NM_003482.3'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: CTG</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.188 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 117.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:69548-6;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "69548-6" ];
       fhir:Coding.display [ fhir:value "Genetic variant assessment" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ]
  ];
  fhir:Observation.performer [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ]
  ];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA9633-4;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA9633-4" ];
       fhir:Coding.display [ fhir:value "Present" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA26398-0;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA26398-0" ];
       fhir:Coding.display [ fhir:value "Sequencing" ]     ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.identifier [
       fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID" ];
       fhir:Identifier.value [ fhir:value "UNKNOWN" ]     ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48002-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48002-0" ];
         fhir:Coding.display [ fhir:value "Genomic source class" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6684-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6684-0" ];
         fhir:Coding.display [ fhir:value "Somatic" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene studied [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
         fhir:Coding.code [ fhir:value "HGNC:7133" ];
         fhir:Coding.display [ fhir:value "KMT2D" ]       ]     ]
  ], [
     fhir:index 2;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:62374-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "62374-4" ];
         fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA14029-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA14029-5" ];
         fhir:Coding.display [ fhir:value "GRCh37" ]       ]     ]
  ], [
     fhir:index 3;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48004-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48004-6" ];
         fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "c.7900_7901delCA" ];
         fhir:Coding.display [ fhir:value "c.7900_7901delCA" ]       ]     ]
  ], [
     fhir:index 4;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48019-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48019-4" ];
         fhir:Coding.display [ fhir:value "DNA change type" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:0000159" ];
         fhir:Coding.display [ fhir:value "deletion" ]       ]     ]
  ], [
     fhir:index 5;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48005-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48005-3" ];
         fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "p.Q2634Afs*20" ];
         fhir:Coding.display [ fhir:value "p.Q2634Afs*20" ]       ]     ]
  ], [
     fhir:index 6;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes" ];
         fhir:Coding.code [ fhir:value "functional-annotation" ];
         fhir:Coding.display [ fhir:value "functional-annotation" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:0000865" ];
         fhir:Coding.display [ fhir:value "frameshift" ]       ]     ]
  ], [
     fhir:index 7;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:51958-7;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "51958-7" ];
         fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ];
         fhir:Coding.code [ fhir:value "NM_003482.3" ];
         fhir:Coding.display [ fhir:value "NM_003482.3" ]       ]     ]
  ], [
     fhir:index 8;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:69547-8;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "69547-8" ];
         fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ]       ]     ];
     fhir:Observation.component.valueString [ fhir:value "CTG" ]
  ], [
     fhir:index 9;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81258-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81258-6" ];
         fhir:Coding.display [ fhir:value "Sample VAF" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "0.188"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "1" ]     ]
  ], [
     fhir:index 10;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:82121-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "82121-5" ];
         fhir:Coding.display [ fhir:value "Allelic read depth" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "117.0"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "reads per base pair" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "{reads}/{base}" ]     ]
  ].

<urn:uuid:58828523-8893-45fc-973b-16290366c5e5> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: PIK3CA <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:8975' = 'HGNC:8975', given as 'PIK3CA'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.333G&gt;T <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.333G&gt;T' = 'c.333G&gt;T', given as 'c.333G&gt;T'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.K111N <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.K111N' = 'p.K111N', given as 'p.K111N'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_006218.3 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_006218.3' = 'NM_006218.3', given as 'NM_006218.3'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.1471 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 68.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:69548-6;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "69548-6" ];
       fhir:Coding.display [ fhir:value "Genetic variant assessment" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ]
  ];
  fhir:Observation.performer [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ]
  ];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA9633-4;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA9633-4" ];
       fhir:Coding.display [ fhir:value "Present" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA26398-0;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA26398-0" ];
       fhir:Coding.display [ fhir:value "Sequencing" ]     ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.identifier [
       fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID" ];
       fhir:Identifier.value [ fhir:value "UNKNOWN" ]     ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48002-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48002-0" ];
         fhir:Coding.display [ fhir:value "Genomic source class" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6684-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6684-0" ];
         fhir:Coding.display [ fhir:value "Somatic" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene studied [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
         fhir:Coding.code [ fhir:value "HGNC:8975" ];
         fhir:Coding.display [ fhir:value "PIK3CA" ]       ]     ]
  ], [
     fhir:index 2;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:62374-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "62374-4" ];
         fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA14029-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA14029-5" ];
         fhir:Coding.display [ fhir:value "GRCh37" ]       ]     ]
  ], [
     fhir:index 3;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48004-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48004-6" ];
         fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "c.333G>T" ];
         fhir:Coding.display [ fhir:value "c.333G>T" ]       ]     ]
  ], [
     fhir:index 4;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48019-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48019-4" ];
         fhir:Coding.display [ fhir:value "DNA change type" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:1000002" ];
         fhir:Coding.display [ fhir:value "substitution" ]       ]     ]
  ], [
     fhir:index 5;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48005-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48005-3" ];
         fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "p.K111N" ];
         fhir:Coding.display [ fhir:value "p.K111N" ]       ]     ]
  ], [
     fhir:index 6;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes" ];
         fhir:Coding.code [ fhir:value "functional-annotation" ];
         fhir:Coding.display [ fhir:value "functional-annotation" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:0001583" ];
         fhir:Coding.display [ fhir:value "missense_variant" ]       ]     ]
  ], [
     fhir:index 7;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:51958-7;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "51958-7" ];
         fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ];
         fhir:Coding.code [ fhir:value "NM_006218.3" ];
         fhir:Coding.display [ fhir:value "NM_006218.3" ]       ]     ]
  ], [
     fhir:index 8;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:69547-8;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "69547-8" ];
         fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ]       ]     ];
     fhir:Observation.component.valueString [ fhir:value "G" ]
  ], [
     fhir:index 9;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81258-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81258-6" ];
         fhir:Coding.display [ fhir:value "Sample VAF" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "0.1471"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "1" ]     ]
  ], [
     fhir:index 10;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:82121-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "82121-5" ];
         fhir:Coding.display [ fhir:value "Allelic read depth" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "68.0"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "reads per base pair" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "{reads}/{base}" ]     ]
  ].

<urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: IRS2 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:6126' = 'HGNC:6126', given as 'IRS2'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.3960C&gt;T <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.3960C&gt;T' = 'c.3960C&gt;T', given as 'c.3960C&gt;T'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.= <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.=' = 'p.=', given as 'p.='})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: synonymous_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001819' = 'SO:0001819', given as 'synonymous_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_003749.2 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_003749.2' = 'NM_003749.2', given as 'NM_003749.2'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.1343 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 134.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:69548-6;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "69548-6" ];
       fhir:Coding.display [ fhir:value "Genetic variant assessment" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ]
  ];
  fhir:Observation.performer [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ]
  ];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA9633-4;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA9633-4" ];
       fhir:Coding.display [ fhir:value "Present" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA26398-0;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA26398-0" ];
       fhir:Coding.display [ fhir:value "Sequencing" ]     ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.identifier [
       fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID" ];
       fhir:Identifier.value [ fhir:value "UNKNOWN" ]     ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48002-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48002-0" ];
         fhir:Coding.display [ fhir:value "Genomic source class" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6684-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6684-0" ];
         fhir:Coding.display [ fhir:value "Somatic" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene studied [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
         fhir:Coding.code [ fhir:value "HGNC:6126" ];
         fhir:Coding.display [ fhir:value "IRS2" ]       ]     ]
  ], [
     fhir:index 2;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:62374-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "62374-4" ];
         fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA14029-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA14029-5" ];
         fhir:Coding.display [ fhir:value "GRCh37" ]       ]     ]
  ], [
     fhir:index 3;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48004-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48004-6" ];
         fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "c.3960C>T" ];
         fhir:Coding.display [ fhir:value "c.3960C>T" ]       ]     ]
  ], [
     fhir:index 4;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48019-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48019-4" ];
         fhir:Coding.display [ fhir:value "DNA change type" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:1000002" ];
         fhir:Coding.display [ fhir:value "substitution" ]       ]     ]
  ], [
     fhir:index 5;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48005-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48005-3" ];
         fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "p.=" ];
         fhir:Coding.display [ fhir:value "p.=" ]       ]     ]
  ], [
     fhir:index 6;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes" ];
         fhir:Coding.code [ fhir:value "functional-annotation" ];
         fhir:Coding.display [ fhir:value "functional-annotation" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:0001819" ];
         fhir:Coding.display [ fhir:value "synonymous_variant" ]       ]     ]
  ], [
     fhir:index 7;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:51958-7;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "51958-7" ];
         fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ];
         fhir:Coding.code [ fhir:value "NM_003749.2" ];
         fhir:Coding.display [ fhir:value "NM_003749.2" ]       ]     ]
  ], [
     fhir:index 8;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:69547-8;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "69547-8" ];
         fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ]       ]     ];
     fhir:Observation.component.valueString [ fhir:value "G" ]
  ], [
     fhir:index 9;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81258-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81258-6" ];
         fhir:Coding.display [ fhir:value "Sample VAF" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "0.1343"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "1" ]     ]
  ], [
     fhir:index 10;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:82121-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "82121-5" ];
         fhir:Coding.display [ fhir:value "Allelic read depth" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "134.0"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "reads per base pair" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "{reads}/{base}" ]     ]
  ].

<urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: CDKN2A <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:1787' = 'HGNC:1787', given as 'CDKN2A'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.9_32del <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.9_32del' = 'c.9_32del', given as 'c.9_32del'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: deletion <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0000159' = 'SO:0000159', given as 'deletion'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.A4_P11del <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.A4_P11del' = 'p.A4_P11del', given as 'p.A4_P11del'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: inframe_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001650' = 'SO:0001650', given as 'inframe_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_000077.4 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_000077.4' = 'NM_000077.4', given as 'NM_000077.4'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: AGGCTCCATGCTGCTCCCCGCCGCC</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.0536 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 112.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:69548-6;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "69548-6" ];
       fhir:Coding.display [ fhir:value "Genetic variant assessment" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ]
  ];
  fhir:Observation.performer [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ]
  ];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA9633-4;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA9633-4" ];
       fhir:Coding.display [ fhir:value "Present" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA26398-0;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA26398-0" ];
       fhir:Coding.display [ fhir:value "Sequencing" ]     ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.identifier [
       fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID" ];
       fhir:Identifier.value [ fhir:value "UNKNOWN" ]     ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48002-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48002-0" ];
         fhir:Coding.display [ fhir:value "Genomic source class" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6684-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6684-0" ];
         fhir:Coding.display [ fhir:value "Somatic" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene studied [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
         fhir:Coding.code [ fhir:value "HGNC:1787" ];
         fhir:Coding.display [ fhir:value "CDKN2A" ]       ]     ]
  ], [
     fhir:index 2;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:62374-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "62374-4" ];
         fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA14029-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA14029-5" ];
         fhir:Coding.display [ fhir:value "GRCh37" ]       ]     ]
  ], [
     fhir:index 3;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48004-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48004-6" ];
         fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "c.9_32del" ];
         fhir:Coding.display [ fhir:value "c.9_32del" ]       ]     ]
  ], [
     fhir:index 4;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48019-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48019-4" ];
         fhir:Coding.display [ fhir:value "DNA change type" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:0000159" ];
         fhir:Coding.display [ fhir:value "deletion" ]       ]     ]
  ], [
     fhir:index 5;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48005-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48005-3" ];
         fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "p.A4_P11del" ];
         fhir:Coding.display [ fhir:value "p.A4_P11del" ]       ]     ]
  ], [
     fhir:index 6;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes" ];
         fhir:Coding.code [ fhir:value "functional-annotation" ];
         fhir:Coding.display [ fhir:value "functional-annotation" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:0001650" ];
         fhir:Coding.display [ fhir:value "inframe_variant" ]       ]     ]
  ], [
     fhir:index 7;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:51958-7;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "51958-7" ];
         fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ];
         fhir:Coding.code [ fhir:value "NM_000077.4" ];
         fhir:Coding.display [ fhir:value "NM_000077.4" ]       ]     ]
  ], [
     fhir:index 8;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:69547-8;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "69547-8" ];
         fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ]       ]     ];
     fhir:Observation.component.valueString [ fhir:value "AGGCTCCATGCTGCTCCCCGCCGCC" ]
  ], [
     fhir:index 9;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81258-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81258-6" ];
         fhir:Coding.display [ fhir:value "Sample VAF" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "0.0536"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "1" ]     ]
  ], [
     fhir:index 10;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:82121-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "82121-5" ];
         fhir:Coding.display [ fhir:value "Allelic read depth" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "112.0"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "reads per base pair" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "{reads}/{base}" ]     ]
  ].

<urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: RECQL4 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:9949' = 'HGNC:9949', given as 'RECQL4'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.2086C&gt;T <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.2086C&gt;T' = 'c.2086C&gt;T', given as 'c.2086C&gt;T'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.R696C <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.R696C' = 'p.R696C', given as 'p.R696C'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_004260.3 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_004260.3' = 'NM_004260.3', given as 'NM_004260.3'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.2568 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 148.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:69548-6;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "69548-6" ];
       fhir:Coding.display [ fhir:value "Genetic variant assessment" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ]
  ];
  fhir:Observation.performer [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ]
  ];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA9633-4;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA9633-4" ];
       fhir:Coding.display [ fhir:value "Present" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA26398-0;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA26398-0" ];
       fhir:Coding.display [ fhir:value "Sequencing" ]     ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.identifier [
       fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID" ];
       fhir:Identifier.value [ fhir:value "UNKNOWN" ]     ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48002-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48002-0" ];
         fhir:Coding.display [ fhir:value "Genomic source class" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6684-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6684-0" ];
         fhir:Coding.display [ fhir:value "Somatic" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene studied [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
         fhir:Coding.code [ fhir:value "HGNC:9949" ];
         fhir:Coding.display [ fhir:value "RECQL4" ]       ]     ]
  ], [
     fhir:index 2;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:62374-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "62374-4" ];
         fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA14029-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA14029-5" ];
         fhir:Coding.display [ fhir:value "GRCh37" ]       ]     ]
  ], [
     fhir:index 3;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48004-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48004-6" ];
         fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "c.2086C>T" ];
         fhir:Coding.display [ fhir:value "c.2086C>T" ]       ]     ]
  ], [
     fhir:index 4;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48019-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48019-4" ];
         fhir:Coding.display [ fhir:value "DNA change type" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:1000002" ];
         fhir:Coding.display [ fhir:value "substitution" ]       ]     ]
  ], [
     fhir:index 5;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48005-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48005-3" ];
         fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "p.R696C" ];
         fhir:Coding.display [ fhir:value "p.R696C" ]       ]     ]
  ], [
     fhir:index 6;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes" ];
         fhir:Coding.code [ fhir:value "functional-annotation" ];
         fhir:Coding.display [ fhir:value "functional-annotation" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:0001583" ];
         fhir:Coding.display [ fhir:value "missense_variant" ]       ]     ]
  ], [
     fhir:index 7;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:51958-7;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "51958-7" ];
         fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ];
         fhir:Coding.code [ fhir:value "NM_004260.3" ];
         fhir:Coding.display [ fhir:value "NM_004260.3" ]       ]     ]
  ], [
     fhir:index 8;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:69547-8;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "69547-8" ];
         fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ]       ]     ];
     fhir:Observation.component.valueString [ fhir:value "G" ]
  ], [
     fhir:index 9;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81258-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81258-6" ];
         fhir:Coding.display [ fhir:value "Sample VAF" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "0.2568"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "1" ]     ]
  ], [
     fhir:index 10;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:82121-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "82121-5" ];
         fhir:Coding.display [ fhir:value "Allelic read depth" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "148.0"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "reads per base pair" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "{reads}/{base}" ]     ]
  ].

<urn:uuid:c3587931-242f-4129-93f9-be24500c8f29> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: RYR1 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:10483' = 'HGNC:10483', given as 'RYR1'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.4964G&gt;A <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.4964G&gt;A' = 'c.4964G&gt;A', given as 'c.4964G&gt;A'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.R1655H <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.R1655H' = 'p.R1655H', given as 'p.R1655H'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_000540.2 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_000540.2' = 'NM_000540.2', given as 'NM_000540.2'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.2151 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 93.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:69548-6;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "69548-6" ];
       fhir:Coding.display [ fhir:value "Genetic variant assessment" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ]
  ];
  fhir:Observation.performer [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ]
  ];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA9633-4;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA9633-4" ];
       fhir:Coding.display [ fhir:value "Present" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA26398-0;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA26398-0" ];
       fhir:Coding.display [ fhir:value "Sequencing" ]     ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.identifier [
       fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID" ];
       fhir:Identifier.value [ fhir:value "UNKNOWN" ]     ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48002-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48002-0" ];
         fhir:Coding.display [ fhir:value "Genomic source class" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6684-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6684-0" ];
         fhir:Coding.display [ fhir:value "Somatic" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene studied [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
         fhir:Coding.code [ fhir:value "HGNC:10483" ];
         fhir:Coding.display [ fhir:value "RYR1" ]       ]     ]
  ], [
     fhir:index 2;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:62374-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "62374-4" ];
         fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA14029-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA14029-5" ];
         fhir:Coding.display [ fhir:value "GRCh37" ]       ]     ]
  ], [
     fhir:index 3;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48004-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48004-6" ];
         fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "c.4964G>A" ];
         fhir:Coding.display [ fhir:value "c.4964G>A" ]       ]     ]
  ], [
     fhir:index 4;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48019-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48019-4" ];
         fhir:Coding.display [ fhir:value "DNA change type" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:1000002" ];
         fhir:Coding.display [ fhir:value "substitution" ]       ]     ]
  ], [
     fhir:index 5;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48005-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48005-3" ];
         fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "p.R1655H" ];
         fhir:Coding.display [ fhir:value "p.R1655H" ]       ]     ]
  ], [
     fhir:index 6;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes" ];
         fhir:Coding.code [ fhir:value "functional-annotation" ];
         fhir:Coding.display [ fhir:value "functional-annotation" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:0001583" ];
         fhir:Coding.display [ fhir:value "missense_variant" ]       ]     ]
  ], [
     fhir:index 7;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:51958-7;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "51958-7" ];
         fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ];
         fhir:Coding.code [ fhir:value "NM_000540.2" ];
         fhir:Coding.display [ fhir:value "NM_000540.2" ]       ]     ]
  ], [
     fhir:index 8;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:69547-8;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "69547-8" ];
         fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ]       ]     ];
     fhir:Observation.component.valueString [ fhir:value "G" ]
  ], [
     fhir:index 9;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81258-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81258-6" ];
         fhir:Coding.display [ fhir:value "Sample VAF" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "0.2151"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "1" ]     ]
  ], [
     fhir:index 10;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:82121-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "82121-5" ];
         fhir:Coding.display [ fhir:value "Allelic read depth" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "93.0"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "reads per base pair" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "{reads}/{base}" ]     ]
  ].

<urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: SACS <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:10519' = 'HGNC:10519', given as 'SACS'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.12118G&gt;A <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.12118G&gt;A' = 'c.12118G&gt;A', given as 'c.12118G&gt;A'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.A4040T <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.A4040T' = 'p.A4040T', given as 'p.A4040T'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_014363.5 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_014363.5' = 'NM_014363.5', given as 'NM_014363.5'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.3333 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 60.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:69548-6;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "69548-6" ];
       fhir:Coding.display [ fhir:value "Genetic variant assessment" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ]
  ];
  fhir:Observation.performer [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ]
  ];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA9633-4;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA9633-4" ];
       fhir:Coding.display [ fhir:value "Present" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA26398-0;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA26398-0" ];
       fhir:Coding.display [ fhir:value "Sequencing" ]     ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.identifier [
       fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID" ];
       fhir:Identifier.value [ fhir:value "UNKNOWN" ]     ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48002-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48002-0" ];
         fhir:Coding.display [ fhir:value "Genomic source class" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6684-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6684-0" ];
         fhir:Coding.display [ fhir:value "Somatic" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene studied [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
         fhir:Coding.code [ fhir:value "HGNC:10519" ];
         fhir:Coding.display [ fhir:value "SACS" ]       ]     ]
  ], [
     fhir:index 2;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:62374-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "62374-4" ];
         fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA14029-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA14029-5" ];
         fhir:Coding.display [ fhir:value "GRCh37" ]       ]     ]
  ], [
     fhir:index 3;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48004-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48004-6" ];
         fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "c.12118G>A" ];
         fhir:Coding.display [ fhir:value "c.12118G>A" ]       ]     ]
  ], [
     fhir:index 4;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48019-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48019-4" ];
         fhir:Coding.display [ fhir:value "DNA change type" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:1000002" ];
         fhir:Coding.display [ fhir:value "substitution" ]       ]     ]
  ], [
     fhir:index 5;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48005-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48005-3" ];
         fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "p.A4040T" ];
         fhir:Coding.display [ fhir:value "p.A4040T" ]       ]     ]
  ], [
     fhir:index 6;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes" ];
         fhir:Coding.code [ fhir:value "functional-annotation" ];
         fhir:Coding.display [ fhir:value "functional-annotation" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:0001583" ];
         fhir:Coding.display [ fhir:value "missense_variant" ]       ]     ]
  ], [
     fhir:index 7;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:51958-7;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "51958-7" ];
         fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ];
         fhir:Coding.code [ fhir:value "NM_014363.5" ];
         fhir:Coding.display [ fhir:value "NM_014363.5" ]       ]     ]
  ], [
     fhir:index 8;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:69547-8;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "69547-8" ];
         fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ]       ]     ];
     fhir:Observation.component.valueString [ fhir:value "C" ]
  ], [
     fhir:index 9;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81258-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81258-6" ];
         fhir:Coding.display [ fhir:value "Sample VAF" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "0.3333"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "1" ]     ]
  ], [
     fhir:index 10;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:82121-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "82121-5" ];
         fhir:Coding.display [ fhir:value "Allelic read depth" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "60.0"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "reads per base pair" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "{reads}/{base}" ]     ]
  ].

<urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: SLIT2 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:11086' = 'HGNC:11086', given as 'SLIT2'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.1290C&gt;A <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.1290C&gt;A' = 'c.1290C&gt;A', given as 'c.1290C&gt;A'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.N430K <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.N430K' = 'p.N430K', given as 'p.N430K'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_004787.3 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_004787.3' = 'NM_004787.3', given as 'NM_004787.3'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.2642 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 53.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:69548-6;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "69548-6" ];
       fhir:Coding.display [ fhir:value "Genetic variant assessment" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ]
  ];
  fhir:Observation.performer [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ]
  ];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA9633-4;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA9633-4" ];
       fhir:Coding.display [ fhir:value "Present" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA26398-0;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA26398-0" ];
       fhir:Coding.display [ fhir:value "Sequencing" ]     ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.identifier [
       fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID" ];
       fhir:Identifier.value [ fhir:value "UNKNOWN" ]     ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48002-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48002-0" ];
         fhir:Coding.display [ fhir:value "Genomic source class" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6684-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6684-0" ];
         fhir:Coding.display [ fhir:value "Somatic" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene studied [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
         fhir:Coding.code [ fhir:value "HGNC:11086" ];
         fhir:Coding.display [ fhir:value "SLIT2" ]       ]     ]
  ], [
     fhir:index 2;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:62374-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "62374-4" ];
         fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA14029-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA14029-5" ];
         fhir:Coding.display [ fhir:value "GRCh37" ]       ]     ]
  ], [
     fhir:index 3;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48004-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48004-6" ];
         fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "c.1290C>A" ];
         fhir:Coding.display [ fhir:value "c.1290C>A" ]       ]     ]
  ], [
     fhir:index 4;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48019-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48019-4" ];
         fhir:Coding.display [ fhir:value "DNA change type" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:1000002" ];
         fhir:Coding.display [ fhir:value "substitution" ]       ]     ]
  ], [
     fhir:index 5;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48005-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48005-3" ];
         fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "p.N430K" ];
         fhir:Coding.display [ fhir:value "p.N430K" ]       ]     ]
  ], [
     fhir:index 6;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes" ];
         fhir:Coding.code [ fhir:value "functional-annotation" ];
         fhir:Coding.display [ fhir:value "functional-annotation" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:0001583" ];
         fhir:Coding.display [ fhir:value "missense_variant" ]       ]     ]
  ], [
     fhir:index 7;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:51958-7;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "51958-7" ];
         fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ];
         fhir:Coding.code [ fhir:value "NM_004787.3" ];
         fhir:Coding.display [ fhir:value "NM_004787.3" ]       ]     ]
  ], [
     fhir:index 8;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:69547-8;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "69547-8" ];
         fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ]       ]     ];
     fhir:Observation.component.valueString [ fhir:value "C" ]
  ], [
     fhir:index 9;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81258-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81258-6" ];
         fhir:Coding.display [ fhir:value "Sample VAF" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "0.2642"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "1" ]     ]
  ], [
     fhir:index 10;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:82121-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "82121-5" ];
         fhir:Coding.display [ fhir:value "Allelic read depth" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "53.0"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "reads per base pair" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "{reads}/{base}" ]     ]
  ].

<urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: SMARCA4 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:11100' = 'HGNC:11100', given as 'SMARCA4'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.2372C&gt;T <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.2372C&gt;T' = 'c.2372C&gt;T', given as 'c.2372C&gt;T'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.A791V <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.A791V' = 'p.A791V', given as 'p.A791V'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_001128849.1 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_001128849.1' = 'NM_001128849.1', given as 'NM_001128849.1'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.1938 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 160.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:69548-6;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "69548-6" ];
       fhir:Coding.display [ fhir:value "Genetic variant assessment" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ]
  ];
  fhir:Observation.performer [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ]
  ];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA9633-4;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA9633-4" ];
       fhir:Coding.display [ fhir:value "Present" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:LA26398-0;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "LA26398-0" ];
       fhir:Coding.display [ fhir:value "Sequencing" ]     ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.identifier [
       fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID" ];
       fhir:Identifier.value [ fhir:value "UNKNOWN" ]     ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48002-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48002-0" ];
         fhir:Coding.display [ fhir:value "Genomic source class" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6684-0;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6684-0" ];
         fhir:Coding.display [ fhir:value "Somatic" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene studied [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org/geneId" ];
         fhir:Coding.code [ fhir:value "HGNC:11100" ];
         fhir:Coding.display [ fhir:value "SMARCA4" ]       ]     ]
  ], [
     fhir:index 2;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:62374-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "62374-4" ];
         fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA14029-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA14029-5" ];
         fhir:Coding.display [ fhir:value "GRCh37" ]       ]     ]
  ], [
     fhir:index 3;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48004-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48004-6" ];
         fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "c.2372C>T" ];
         fhir:Coding.display [ fhir:value "c.2372C>T" ]       ]     ]
  ], [
     fhir:index 4;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48019-4;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48019-4" ];
         fhir:Coding.display [ fhir:value "DNA change type" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:1000002" ];
         fhir:Coding.display [ fhir:value "substitution" ]       ]     ]
  ], [
     fhir:index 5;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48005-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48005-3" ];
         fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ];
         fhir:Coding.code [ fhir:value "p.A791V" ];
         fhir:Coding.display [ fhir:value "p.A791V" ]       ]     ]
  ], [
     fhir:index 6;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes" ];
         fhir:Coding.code [ fhir:value "functional-annotation" ];
         fhir:Coding.display [ fhir:value "functional-annotation" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ];
         fhir:Coding.code [ fhir:value "SO:0001583" ];
         fhir:Coding.display [ fhir:value "missense_variant" ]       ]     ]
  ], [
     fhir:index 7;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:51958-7;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "51958-7" ];
         fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ];
         fhir:Coding.code [ fhir:value "NM_001128849.1" ];
         fhir:Coding.display [ fhir:value "NM_001128849.1" ]       ]     ]
  ], [
     fhir:index 8;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:69547-8;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "69547-8" ];
         fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ]       ]     ];
     fhir:Observation.component.valueString [ fhir:value "C" ]
  ], [
     fhir:index 9;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81258-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81258-6" ];
         fhir:Coding.display [ fhir:value "Sample VAF" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "0.1938"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "1" ]     ]
  ], [
     fhir:index 10;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:82121-5;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "82121-5" ];
         fhir:Coding.display [ fhir:value "Allelic read depth" ]       ]     ];
     fhir:Observation.component.valueQuantity [
       fhir:Quantity.value [ fhir:value "160.0"^^xsd:decimal ];
       fhir:Quantity.unit [ fhir:value "reads per base pair" ];
       fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ];
       fhir:Quantity.code [ fhir:value "{reads}/{base}" ]     ]
  ].

<urn:uuid:6a80003f-822d-489e-8286-1f1dcba56dfa> a fhir:DiagnosticReport;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>identifier</b>: 42867</p><p><b>status</b>: final</p><p><b>category</b>: Genetics <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/v2-0074 code 'GE' = 'Genetics', given as 'Genetics'})</span></p><p><b>code</b>: Master HL7 genetic variant reporting panel <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81247-9' = 'Master HL7 genetic variant reporting panel', given as 'Master HL7 genetic variant reporting panel'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>issued</b>: Sep 15, 2019 11:35:05 AM</p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>specimen</b>: <a href=\"urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516\">urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516</a></p><p><b>result</b>: </p><ul><li><a href=\"urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae\">urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae</a></li><li><a href=\"urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00\">urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00</a></li><li><a href=\"urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5\">urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5</a></li><li><a href=\"urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358\">urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358</a></li><li><a href=\"urn:uuid:58828523-8893-45fc-973b-16290366c5e5\">urn:uuid:58828523-8893-45fc-973b-16290366c5e5</a></li><li><a href=\"urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2\">urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2</a></li><li><a href=\"urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1\">urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1</a></li><li><a href=\"urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf\">urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf</a></li><li><a href=\"urn:uuid:c3587931-242f-4129-93f9-be24500c8f29\">urn:uuid:c3587931-242f-4129-93f9-be24500c8f29</a></li><li><a href=\"urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6\">urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6</a></li><li><a href=\"urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2\">urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2</a></li><li><a href=\"urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca\">urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca</a></li></ul></div>"
  ];
  fhir:DiagnosticReport.identifier [
     fhir:index 0;
     fhir:Identifier.system [ fhir:value "http://molit.eu/fhir/genomics/NamingSystem/cegat/reportID" ];
     fhir:Identifier.value [ fhir:value "42867" ]
  ];
  fhir:DiagnosticReport.status [ fhir:value "final"];
  fhir:DiagnosticReport.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ];
       fhir:Coding.code [ fhir:value "GE" ];
       fhir:Coding.display [ fhir:value "Genetics" ]     ]
  ];
  fhir:DiagnosticReport.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:81247-9;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "81247-9" ];
       fhir:Coding.display [ fhir:value "Master HL7 genetic variant reporting panel" ]     ]
  ];
  fhir:DiagnosticReport.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ]
  ];
  fhir:DiagnosticReport.issued [ fhir:value "2019-09-15T11:35:05.722-04:00"^^xsd:dateTime];
  fhir:DiagnosticReport.performer [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ]
  ];
  fhir:DiagnosticReport.specimen [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516" ]
  ];
  fhir:DiagnosticReport.result [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00" ]
  ], [
     fhir:index 2;
     fhir:Reference.reference [ fhir:value "urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5" ]
  ], [
     fhir:index 3;
     fhir:Reference.reference [ fhir:value "urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358" ]
  ], [
     fhir:index 4;
     fhir:Reference.reference [ fhir:value "urn:uuid:58828523-8893-45fc-973b-16290366c5e5" ]
  ], [
     fhir:index 5;
     fhir:Reference.reference [ fhir:value "urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2" ]
  ], [
     fhir:index 6;
     fhir:Reference.reference [ fhir:value "urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1" ]
  ], [
     fhir:index 7;
     fhir:Reference.reference [ fhir:value "urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf" ]
  ], [
     fhir:index 8;
     fhir:Reference.reference [ fhir:value "urn:uuid:c3587931-242f-4129-93f9-be24500c8f29" ]
  ], [
     fhir:index 9;
     fhir:Reference.reference [ fhir:value "urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6" ]
  ], [
     fhir:index 10;
     fhir:Reference.reference [ fhir:value "urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2" ]
  ], [
     fhir:index 11;
     fhir:Reference.reference [ fhir:value "urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca" ]
  ].

# - ontology header ------------------------------------------------------------

 a owl:Ontology;
  owl:imports fhir:fhir.ttl.