Genomics Reporting Implementation Guide (STU1)
This page is part of the Genetic Reporting Implementation Guide (v1.0.0: STU 1) based on FHIR R4. The current version which supercedes this version is 2.0.0. For a full list of available versions, see the Directory of published versions 
{
"resourceType" : "Bundle",
"id" : "oncology-report-example",
"type" : "transaction",
"entry" : [
{
"fullUrl" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17",
"resource" : {
"resourceType" : "Organization",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>identifier</b>: CEGAT</p><p><b>name</b>: CEGAT</p></div>"
},
"identifier" : [
{
"system" : "http://molit.eu/fhir/genomics/NamingSystem/organization",
"value" : "CEGAT"
}
],
"name" : "CEGAT"
},
"request" : {
"method" : "POST",
"url" : "Organization",
"ifNoneExist" : "identifier=http://molit.eu/fhir/genomics/NamingSystem/organization|CEGAT"
}
},
{
"fullUrl" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648",
"resource" : {
"resourceType" : "Patient",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>identifier</b>: 11111</p></div>"
},
"identifier" : [
{
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/patID",
"value" : "11111"
}
]
},
"request" : {
"method" : "POST",
"url" : "Patient",
"ifNoneExist" : "identifier=http://molit.eu/fhir/genomics/NamingSystem/cegat/patID|11111"
}
},
{
"fullUrl" : "urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516",
"resource" : {
"resourceType" : "Specimen",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>identifier</b>: UNKNOWN</p><p><b>type</b>: Tumor <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/v2-0487 code 'TUMOR' = 'Tumor', given as 'Tumor'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><h3>Collections</h3><table class=\"grid\"><tr><td>-</td><td><b>Method</b></td><td><b>BodySite</b></td></tr><tr><td>*</td><td>Biopsie <span style=\"background: LightGoldenRodYellow\">(Details : {http://molit.eu/fhir/IG_TODO code 'Biopsy' = 'Biopsy', given as 'Biopsie'})</span></td><td>C16.0 <span style=\"background: LightGoldenRodYellow\">(Details : {http://example.org/fhir/sid/icd-9-cm code 'C16.0' = 'C16.0)</span></td></tr></table></div>"
},
"identifier" : [
{
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
],
"type" : {
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0487",
"code" : "TUMOR",
"display" : "Tumor"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"collection" : {
"method" : {
"coding" : [
{
"system" : "http://molit.eu/fhir/IG_TODO",
"code" : "Biopsy",
"display" : "Biopsie"
}
]
},
"bodySite" : {
"coding" : [
{
"system" : "http://example.org/fhir/sid/icd-9-cm",
"code" : "C16.0"
}
]
}
}
},
"request" : {
"method" : "POST",
"url" : "Specimen",
"ifNoneExist" : "identifier=http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID|UNKNOWN"
}
},
{
"fullUrl" : "urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: PIK3CA <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:8975' = 'HGNC:8975', given as 'PIK3CA'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.3140A>G <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.3140A>G' = 'c.3140A>G', given as 'c.3140A>G'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.H1047R <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.H1047R' = 'p.H1047R', given as 'p.H1047R'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_006218.3 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_006218.3' = 'NM_006218.3', given as 'NM_006218.3'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: A</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.2188 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 64.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:8975",
"display" : "PIK3CA"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.3140A>G",
"display" : "c.3140A>G"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.H1047R",
"display" : "p.H1047R"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes",
"code" : "functional-annotation",
"display" : "functional-annotation"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_006218.3",
"display" : "NM_006218.3"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "A"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.2188,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 64.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: NRAS <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:7989' = 'HGNC:7989', given as 'NRAS'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.34G>T <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.34G>T' = 'c.34G>T', given as 'c.34G>T'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.G12C <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.G12C' = 'p.G12C', given as 'p.G12C'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_002524.4 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_002524.4' = 'NM_002524.4', given as 'NM_002524.4'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.1793 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 145.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:7989",
"display" : "NRAS"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.34G>T",
"display" : "c.34G>T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.G12C",
"display" : "p.G12C"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes",
"code" : "functional-annotation",
"display" : "functional-annotation"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_002524.4",
"display" : "NM_002524.4"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "C"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.1793,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 145.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: FBXW7 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:16712' = 'HGNC:16712', given as 'FBXW7'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.1394G>A <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.1394G>A' = 'c.1394G>A', given as 'c.1394G>A'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.R465H <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.R465H' = 'p.R465H', given as 'p.R465H'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_001349798.2 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_001349798.2' = 'NM_001349798.2', given as 'NM_001349798.2'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.1053 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 57.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:16712",
"display" : "FBXW7"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.1394G>A",
"display" : "c.1394G>A"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.R465H",
"display" : "p.R465H"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes",
"code" : "functional-annotation",
"display" : "functional-annotation"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_001349798.2",
"display" : "NM_001349798.2"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "C"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.1053,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 57.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: KMT2D <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:7133' = 'HGNC:7133', given as 'KMT2D'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.7900_7901delCA <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.7900_7901delCA' = 'c.7900_7901delCA', given as 'c.7900_7901delCA'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: deletion <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0000159' = 'SO:0000159', given as 'deletion'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.Q2634Afs*20 <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.Q2634Afs*20' = 'p.Q2634Afs*20', given as 'p.Q2634Afs*20'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: frameshift <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0000865' = 'SO:0000865', given as 'frameshift'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_003482.3 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_003482.3' = 'NM_003482.3', given as 'NM_003482.3'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: CTG</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.188 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 117.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:7133",
"display" : "KMT2D"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.7900_7901delCA",
"display" : "c.7900_7901delCA"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0000159",
"display" : "deletion"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.Q2634Afs*20",
"display" : "p.Q2634Afs*20"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes",
"code" : "functional-annotation",
"display" : "functional-annotation"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0000865",
"display" : "frameshift"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_003482.3",
"display" : "NM_003482.3"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "CTG"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.188,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 117.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:58828523-8893-45fc-973b-16290366c5e5",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: PIK3CA <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:8975' = 'HGNC:8975', given as 'PIK3CA'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.333G>T <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.333G>T' = 'c.333G>T', given as 'c.333G>T'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.K111N <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.K111N' = 'p.K111N', given as 'p.K111N'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_006218.3 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_006218.3' = 'NM_006218.3', given as 'NM_006218.3'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.1471 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 68.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:8975",
"display" : "PIK3CA"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.333G>T",
"display" : "c.333G>T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.K111N",
"display" : "p.K111N"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes",
"code" : "functional-annotation",
"display" : "functional-annotation"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_006218.3",
"display" : "NM_006218.3"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "G"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.1471,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 68.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: IRS2 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:6126' = 'HGNC:6126', given as 'IRS2'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.3960C>T <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.3960C>T' = 'c.3960C>T', given as 'c.3960C>T'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.= <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.=' = 'p.=', given as 'p.='})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: synonymous_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001819' = 'SO:0001819', given as 'synonymous_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_003749.2 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_003749.2' = 'NM_003749.2', given as 'NM_003749.2'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.1343 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 134.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:6126",
"display" : "IRS2"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.3960C>T",
"display" : "c.3960C>T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.=",
"display" : "p.="
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes",
"code" : "functional-annotation",
"display" : "functional-annotation"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001819",
"display" : "synonymous_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_003749.2",
"display" : "NM_003749.2"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "G"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.1343,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 134.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: CDKN2A <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:1787' = 'HGNC:1787', given as 'CDKN2A'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.9_32del <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.9_32del' = 'c.9_32del', given as 'c.9_32del'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: deletion <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0000159' = 'SO:0000159', given as 'deletion'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.A4_P11del <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.A4_P11del' = 'p.A4_P11del', given as 'p.A4_P11del'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: inframe_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001650' = 'SO:0001650', given as 'inframe_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_000077.4 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_000077.4' = 'NM_000077.4', given as 'NM_000077.4'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: AGGCTCCATGCTGCTCCCCGCCGCC</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.0536 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 112.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:1787",
"display" : "CDKN2A"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.9_32del",
"display" : "c.9_32del"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0000159",
"display" : "deletion"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.A4_P11del",
"display" : "p.A4_P11del"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes",
"code" : "functional-annotation",
"display" : "functional-annotation"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001650",
"display" : "inframe_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_000077.4",
"display" : "NM_000077.4"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "AGGCTCCATGCTGCTCCCCGCCGCC"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.0536,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 112.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: RECQL4 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:9949' = 'HGNC:9949', given as 'RECQL4'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.2086C>T <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.2086C>T' = 'c.2086C>T', given as 'c.2086C>T'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.R696C <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.R696C' = 'p.R696C', given as 'p.R696C'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_004260.3 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_004260.3' = 'NM_004260.3', given as 'NM_004260.3'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.2568 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 148.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:9949",
"display" : "RECQL4"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.2086C>T",
"display" : "c.2086C>T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.R696C",
"display" : "p.R696C"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes",
"code" : "functional-annotation",
"display" : "functional-annotation"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_004260.3",
"display" : "NM_004260.3"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "G"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.2568,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 148.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:c3587931-242f-4129-93f9-be24500c8f29",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: RYR1 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:10483' = 'HGNC:10483', given as 'RYR1'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.4964G>A <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.4964G>A' = 'c.4964G>A', given as 'c.4964G>A'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.R1655H <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.R1655H' = 'p.R1655H', given as 'p.R1655H'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_000540.2 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_000540.2' = 'NM_000540.2', given as 'NM_000540.2'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.2151 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 93.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:10483",
"display" : "RYR1"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.4964G>A",
"display" : "c.4964G>A"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.R1655H",
"display" : "p.R1655H"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes",
"code" : "functional-annotation",
"display" : "functional-annotation"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_000540.2",
"display" : "NM_000540.2"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "G"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.2151,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 93.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: SACS <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:10519' = 'HGNC:10519', given as 'SACS'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.12118G>A <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.12118G>A' = 'c.12118G>A', given as 'c.12118G>A'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.A4040T <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.A4040T' = 'p.A4040T', given as 'p.A4040T'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_014363.5 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_014363.5' = 'NM_014363.5', given as 'NM_014363.5'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.3333 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 60.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:10519",
"display" : "SACS"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.12118G>A",
"display" : "c.12118G>A"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.A4040T",
"display" : "p.A4040T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes",
"code" : "functional-annotation",
"display" : "functional-annotation"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_014363.5",
"display" : "NM_014363.5"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "C"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.3333,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 60.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: SLIT2 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:11086' = 'HGNC:11086', given as 'SLIT2'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.1290C>A <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.1290C>A' = 'c.1290C>A', given as 'c.1290C>A'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.N430K <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.N430K' = 'p.N430K', given as 'p.N430K'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_004787.3 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_004787.3' = 'NM_004787.3', given as 'NM_004787.3'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.2642 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 53.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:11086",
"display" : "SLIT2"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.1290C>A",
"display" : "c.1290C>A"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.N430K",
"display" : "p.N430K"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes",
"code" : "functional-annotation",
"display" : "functional-annotation"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_004787.3",
"display" : "NM_004787.3"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "C"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.2642,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 53.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69548-6' = 'Genetic variant assessment', given as 'Genetic variant assessment'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA9633-4' = 'Present', given as 'Present'})</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA26398-0' = 'Sequencing', given as 'Sequencing'})</span></p><p><b>specimen</b>: </p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48002-0' = 'Genomic source class [Type]', given as 'Genomic source class'})</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA6684-0' = 'Somatic', given as 'Somatic'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48018-6' = 'Gene studied [ID]', given as 'Gene studied [ID]'})</span></p><p><b>value</b>: SMARCA4 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.genenames.org/geneId code 'HGNC:11100' = 'HGNC:11100', given as 'SMARCA4'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '62374-4' = 'Human reference sequence assembly version', given as 'Human reference sequence assembly version'})</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code 'LA14029-5' = 'GRCh37', given as 'GRCh37'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48004-6' = 'DNA change (c.HGVS)', given as 'DNA change (c.HGVS)'})</span></p><p><b>value</b>: c.2372C>T <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'c.2372C>T' = 'c.2372C>T', given as 'c.2372C>T'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48019-4' = 'DNA Change Type', given as 'DNA change type'})</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:1000002' = 'SO:1000002', given as 'substitution'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '48005-3' = 'Amino acid change (pHGVS)', given as 'Amino acid change (pHGVS)'})</span></p><p><b>value</b>: p.A791V <span style=\"background: LightGoldenRodYellow\">(Details : {http://varnomen.hgvs.org code 'p.A791V' = 'p.A791V', given as 'p.A791V'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: functional-annotation <span style=\"background: LightGoldenRodYellow\">(Details : {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes code 'functional-annotation' = 'functional-annotation', given as 'functional-annotation'})</span></p><p><b>value</b>: missense_variant <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.sequenceontology.org code 'SO:0001583' = 'SO:0001583', given as 'missense_variant'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '51958-7' = 'Transcript reference sequence [ID]', given as 'Transcript reference sequence [ID]'})</span></p><p><b>value</b>: NM_001128849.1 <span style=\"background: LightGoldenRodYellow\">(Details : {http://www.ncbi.nlm.nih.gov/refseq code 'NM_001128849.1' = 'NM_001128849.1', given as 'NM_001128849.1'})</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '69547-8' = 'Genomic ref allele [ID]', given as 'Genomic ref allele [ID]'})</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81258-6' = 'Sample variant allelic frequency [NFr]', given as 'Sample VAF'})</span></p><p><b>value</b>: 0.1938 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '82121-5' = 'Allelic read depth', given as 'Allelic read depth'})</span></p><p><b>value</b>: 160.0 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code {reads}/{base} = '{reads}/{base}')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:11100",
"display" : "SMARCA4"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.2372C>T",
"display" : "c.2372C>T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.A791V",
"display" : "p.A791V"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/tbd-codes",
"code" : "functional-annotation",
"display" : "functional-annotation"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_001128849.1",
"display" : "NM_001128849.1"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "C"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.1938,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 160.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:6a80003f-822d-489e-8286-1f1dcba56dfa",
"resource" : {
"resourceType" : "DiagnosticReport",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative with Details</b></p><p><b>identifier</b>: 42867</p><p><b>status</b>: final</p><p><b>category</b>: Genetics <span style=\"background: LightGoldenRodYellow\">(Details : {http://terminology.hl7.org/CodeSystem/v2-0074 code 'GE' = 'Genetics', given as 'Genetics'})</span></p><p><b>code</b>: Master HL7 genetic variant reporting panel <span style=\"background: LightGoldenRodYellow\">(Details : {LOINC code '81247-9' = 'Master HL7 genetic variant reporting panel', given as 'Master HL7 genetic variant reporting panel'})</span></p><p><b>subject</b>: <a href=\"urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648\">urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</a></p><p><b>issued</b>: Sep 15, 2019 11:35:05 AM</p><p><b>performer</b>: <a href=\"urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17\">urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</a></p><p><b>specimen</b>: <a href=\"urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516\">urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516</a></p><p><b>result</b>: </p><ul><li><a href=\"urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae\">urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae</a></li><li><a href=\"urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00\">urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00</a></li><li><a href=\"urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5\">urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5</a></li><li><a href=\"urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358\">urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358</a></li><li><a href=\"urn:uuid:58828523-8893-45fc-973b-16290366c5e5\">urn:uuid:58828523-8893-45fc-973b-16290366c5e5</a></li><li><a href=\"urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2\">urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2</a></li><li><a href=\"urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1\">urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1</a></li><li><a href=\"urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf\">urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf</a></li><li><a href=\"urn:uuid:c3587931-242f-4129-93f9-be24500c8f29\">urn:uuid:c3587931-242f-4129-93f9-be24500c8f29</a></li><li><a href=\"urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6\">urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6</a></li><li><a href=\"urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2\">urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2</a></li><li><a href=\"urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca\">urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca</a></li></ul></div>"
},
"identifier" : [
{
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/reportID",
"value" : "42867"
}
],
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE",
"display" : "Genetics"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81247-9",
"display" : "Master HL7 genetic variant reporting panel"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"issued" : "2019-09-15T11:35:05.722-04:00",
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"specimen" : [
{
"reference" : "urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516"
}
],
"result" : [
{
"reference" : "urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae"
},
{
"reference" : "urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00"
},
{
"reference" : "urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5"
},
{
"reference" : "urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358"
},
{
"reference" : "urn:uuid:58828523-8893-45fc-973b-16290366c5e5"
},
{
"reference" : "urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2"
},
{
"reference" : "urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1"
},
{
"reference" : "urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf"
},
{
"reference" : "urn:uuid:c3587931-242f-4129-93f9-be24500c8f29"
},
{
"reference" : "urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6"
},
{
"reference" : "urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2"
},
{
"reference" : "urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca"
}
]
},
"request" : {
"method" : "POST",
"url" : "DiagnosticReport"
}
}
]
}
IG © 2017+ HL7 International Clinical Genomics Work Group. Package hl7.fhir.uv.genomics-reporting#1.0.0 based on FHIR 4.0.1. Generated 2019-11-20
Links: Table of Contents |
QA Report | Search |
Version History |
|
Propose a change