Genomics Reporting Implementation Guide
1.1.0 - Ballot
Genomics Reporting Implementation Guide
1.1.0 - Ballot
This page is part of the Genetic Reporting Implementation Guide (v1.1.0: STU 2 Ballot 1) based on FHIR R4. The current version which supercedes this version is 2.0.0. For a full list of available versions, see the Directory of published versions 
{
"resourceType" : "Bundle",
"id" : "oncology-report-example",
"type" : "transaction",
"entry" : [
{
"fullUrl" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17",
"resource" : {
"resourceType" : "Organization",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>identifier</b>: id: CEGAT</p><p><b>name</b>: CEGAT</p></div>"
},
"identifier" : [
{
"system" : "http://molit.eu/fhir/genomics/NamingSystem/organization",
"value" : "CEGAT"
}
],
"name" : "CEGAT"
},
"request" : {
"method" : "POST",
"url" : "Organization",
"ifNoneExist" : "identifier=http://molit.eu/fhir/genomics/NamingSystem/organization|CEGAT"
}
},
{
"fullUrl" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648",
"resource" : {
"resourceType" : "Patient",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>identifier</b>: id: 11111</p></div>"
},
"identifier" : [
{
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/patID",
"value" : "11111"
}
]
},
"request" : {
"method" : "POST",
"url" : "Patient",
"ifNoneExist" : "identifier=http://molit.eu/fhir/genomics/NamingSystem/cegat/patID|11111"
}
},
{
"fullUrl" : "urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516",
"resource" : {
"resourceType" : "Specimen",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>identifier</b>: id: UNKNOWN</p><p><b>type</b>: <span title=\"Codes: {http://terminology.hl7.org/CodeSystem/v2-0487 TUMOR}\">Tumor</span></p><p><b>subject</b>: <a href=\"#urnuuidf7a438e6-f484-453d-97e8-aa4d51008648\">See above (Patient/null)</a></p><h3>Collections</h3><table class=\"grid\"><tr><td>-</td><td><b>Method</b></td><td><b>BodySite</b></td></tr><tr><td>*</td><td><span title=\"Codes: {http://molit.eu/fhir/IG_TODO Biopsy}\">Biopsie</span></td><td><span title=\"Codes: {http://example.org/fhir/sid/icd-9-cm C16.0}\">C16.0</span></td></tr></table></div>"
},
"identifier" : [
{
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
],
"type" : {
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0487",
"code" : "TUMOR",
"display" : "Tumor"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"collection" : {
"method" : {
"coding" : [
{
"system" : "http://molit.eu/fhir/IG_TODO",
"code" : "Biopsy",
"display" : "Biopsie"
}
]
},
"bodySite" : {
"coding" : [
{
"system" : "http://example.org/fhir/sid/icd-9-cm",
"code" : "C16.0"
}
]
}
}
},
"request" : {
"method" : "POST",
"url" : "Specimen",
"ifNoneExist" : "identifier=http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID|UNKNOWN"
}
},
{
"fullUrl" : "urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p></p><p><b>category</b>: <span title=\"Codes: {http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"#urnuuidf7a438e6-f484-453d-97e8-aa4d51008648\">See above (Patient/null)</a></p><p><b>performer</b>: <a href=\"#urnuuidfc16d84c-8584-4e1d-baae-64e2f95bfe17\">See above (Organization/null)</a></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes: {http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: <span></span></p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.genenames.org/geneId HGNC:8975}\">PIK3CA</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org c.3140A>G}\">c.3140A>G</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org p.H1047R}\">p.H1047R</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes molecular-consequence}\">Molecular Consequence</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:0001583}\">missense_variant</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.ncbi.nlm.nih.gov/refseq NM_006218.3}\">NM_006218.3</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: A</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.2188 relative frequency of a particular allele in the specimen</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 64.0 reads per base pair</p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:8975",
"display" : "PIK3CA"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.3140A>G",
"display" : "c.3140A>G"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.H1047R",
"display" : "p.H1047R"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes",
"code" : "molecular-consequence",
"display" : "Molecular Consequence"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_006218.3",
"display" : "NM_006218.3"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "A"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.2188,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 64.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p></p><p><b>category</b>: <span title=\"Codes: {http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"#urnuuidf7a438e6-f484-453d-97e8-aa4d51008648\">See above (Patient/null)</a></p><p><b>performer</b>: <a href=\"#urnuuidfc16d84c-8584-4e1d-baae-64e2f95bfe17\">See above (Organization/null)</a></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes: {http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: <span></span></p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.genenames.org/geneId HGNC:7989}\">NRAS</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org c.34G>T}\">c.34G>T</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org p.G12C}\">p.G12C</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes molecular-consequence}\">Molecular Consequence</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:0001583}\">missense_variant</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.ncbi.nlm.nih.gov/refseq NM_002524.4}\">NM_002524.4</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.1793 relative frequency of a particular allele in the specimen</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 145.0 reads per base pair</p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:7989",
"display" : "NRAS"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.34G>T",
"display" : "c.34G>T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.G12C",
"display" : "p.G12C"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes",
"code" : "molecular-consequence",
"display" : "Molecular Consequence"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_002524.4",
"display" : "NM_002524.4"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "C"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.1793,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 145.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p></p><p><b>category</b>: <span title=\"Codes: {http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"#urnuuidf7a438e6-f484-453d-97e8-aa4d51008648\">See above (Patient/null)</a></p><p><b>performer</b>: <a href=\"#urnuuidfc16d84c-8584-4e1d-baae-64e2f95bfe17\">See above (Organization/null)</a></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes: {http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: <span></span></p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.genenames.org/geneId HGNC:16712}\">FBXW7</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org c.1394G>A}\">c.1394G>A</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org p.R465H}\">p.R465H</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes molecular-consequence}\">Molecular Consequence</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:0001583}\">missense_variant</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.ncbi.nlm.nih.gov/refseq NM_001349798.2}\">NM_001349798.2</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.1053 relative frequency of a particular allele in the specimen</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 57.0 reads per base pair</p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:16712",
"display" : "FBXW7"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.1394G>A",
"display" : "c.1394G>A"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.R465H",
"display" : "p.R465H"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes",
"code" : "molecular-consequence",
"display" : "Molecular Consequence"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_001349798.2",
"display" : "NM_001349798.2"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "C"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.1053,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 57.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p></p><p><b>category</b>: <span title=\"Codes: {http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"#urnuuidf7a438e6-f484-453d-97e8-aa4d51008648\">See above (Patient/null)</a></p><p><b>performer</b>: <a href=\"#urnuuidfc16d84c-8584-4e1d-baae-64e2f95bfe17\">See above (Organization/null)</a></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes: {http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: <span></span></p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.genenames.org/geneId HGNC:7133}\">KMT2D</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org c.7900_7901delCA}\">c.7900_7901delCA</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:0000159}\">deletion</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org p.Q2634Afs*20}\">p.Q2634Afs*20</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes molecular-consequence}\">Molecular Consequence</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:0000865}\">frameshift</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.ncbi.nlm.nih.gov/refseq NM_003482.3}\">NM_003482.3</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: CTG</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.188 relative frequency of a particular allele in the specimen</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 117.0 reads per base pair</p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:7133",
"display" : "KMT2D"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.7900_7901delCA",
"display" : "c.7900_7901delCA"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0000159",
"display" : "deletion"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.Q2634Afs*20",
"display" : "p.Q2634Afs*20"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes",
"code" : "molecular-consequence",
"display" : "Molecular Consequence"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0000865",
"display" : "frameshift"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_003482.3",
"display" : "NM_003482.3"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "CTG"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.188,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 117.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:58828523-8893-45fc-973b-16290366c5e5",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p></p><p><b>category</b>: <span title=\"Codes: {http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"#urnuuidf7a438e6-f484-453d-97e8-aa4d51008648\">See above (Patient/null)</a></p><p><b>performer</b>: <a href=\"#urnuuidfc16d84c-8584-4e1d-baae-64e2f95bfe17\">See above (Organization/null)</a></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes: {http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: <span></span></p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.genenames.org/geneId HGNC:8975}\">PIK3CA</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org c.333G>T}\">c.333G>T</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org p.K111N}\">p.K111N</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes molecular-consequence}\">Molecular Consequence</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:0001583}\">missense_variant</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.ncbi.nlm.nih.gov/refseq NM_006218.3}\">NM_006218.3</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.1471 relative frequency of a particular allele in the specimen</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 68.0 reads per base pair</p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:8975",
"display" : "PIK3CA"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.333G>T",
"display" : "c.333G>T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.K111N",
"display" : "p.K111N"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes",
"code" : "molecular-consequence",
"display" : "Molecular Consequence"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_006218.3",
"display" : "NM_006218.3"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "G"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.1471,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 68.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p></p><p><b>category</b>: <span title=\"Codes: {http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"#urnuuidf7a438e6-f484-453d-97e8-aa4d51008648\">See above (Patient/null)</a></p><p><b>performer</b>: <a href=\"#urnuuidfc16d84c-8584-4e1d-baae-64e2f95bfe17\">See above (Organization/null)</a></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes: {http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: <span></span></p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.genenames.org/geneId HGNC:6126}\">IRS2</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org c.3960C>T}\">c.3960C>T</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org p.=}\">p.=</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes molecular-consequence}\">Molecular Consequence</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:0001819}\">synonymous_variant</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.ncbi.nlm.nih.gov/refseq NM_003749.2}\">NM_003749.2</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.1343 relative frequency of a particular allele in the specimen</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 134.0 reads per base pair</p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:6126",
"display" : "IRS2"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.3960C>T",
"display" : "c.3960C>T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.=",
"display" : "p.="
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes",
"code" : "molecular-consequence",
"display" : "Molecular Consequence"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001819",
"display" : "synonymous_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_003749.2",
"display" : "NM_003749.2"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "G"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.1343,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 134.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p></p><p><b>category</b>: <span title=\"Codes: {http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"#urnuuidf7a438e6-f484-453d-97e8-aa4d51008648\">See above (Patient/null)</a></p><p><b>performer</b>: <a href=\"#urnuuidfc16d84c-8584-4e1d-baae-64e2f95bfe17\">See above (Organization/null)</a></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes: {http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: <span></span></p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.genenames.org/geneId HGNC:1787}\">CDKN2A</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org c.9_32del}\">c.9_32del</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:0000159}\">deletion</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org p.A4_P11del}\">p.A4_P11del</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes molecular-consequence}\">Molecular Consequence</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:0001650}\">inframe_variant</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.ncbi.nlm.nih.gov/refseq NM_000077.4}\">NM_000077.4</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: AGGCTCCATGCTGCTCCCCGCCGCC</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.0536 relative frequency of a particular allele in the specimen</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 112.0 reads per base pair</p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:1787",
"display" : "CDKN2A"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.9_32del",
"display" : "c.9_32del"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0000159",
"display" : "deletion"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.A4_P11del",
"display" : "p.A4_P11del"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes",
"code" : "molecular-consequence",
"display" : "Molecular Consequence"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001650",
"display" : "inframe_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_000077.4",
"display" : "NM_000077.4"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "AGGCTCCATGCTGCTCCCCGCCGCC"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.0536,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 112.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p></p><p><b>category</b>: <span title=\"Codes: {http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"#urnuuidf7a438e6-f484-453d-97e8-aa4d51008648\">See above (Patient/null)</a></p><p><b>performer</b>: <a href=\"#urnuuidfc16d84c-8584-4e1d-baae-64e2f95bfe17\">See above (Organization/null)</a></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes: {http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: <span></span></p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.genenames.org/geneId HGNC:9949}\">RECQL4</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org c.2086C>T}\">c.2086C>T</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org p.R696C}\">p.R696C</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes molecular-consequence}\">Molecular Consequence</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:0001583}\">missense_variant</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.ncbi.nlm.nih.gov/refseq NM_004260.3}\">NM_004260.3</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.2568 relative frequency of a particular allele in the specimen</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 148.0 reads per base pair</p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:9949",
"display" : "RECQL4"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.2086C>T",
"display" : "c.2086C>T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.R696C",
"display" : "p.R696C"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes",
"code" : "molecular-consequence",
"display" : "Molecular Consequence"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_004260.3",
"display" : "NM_004260.3"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "G"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.2568,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 148.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:c3587931-242f-4129-93f9-be24500c8f29",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p></p><p><b>category</b>: <span title=\"Codes: {http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"#urnuuidf7a438e6-f484-453d-97e8-aa4d51008648\">See above (Patient/null)</a></p><p><b>performer</b>: <a href=\"#urnuuidfc16d84c-8584-4e1d-baae-64e2f95bfe17\">See above (Organization/null)</a></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes: {http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: <span></span></p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.genenames.org/geneId HGNC:10483}\">RYR1</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org c.4964G>A}\">c.4964G>A</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org p.R1655H}\">p.R1655H</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes molecular-consequence}\">Molecular Consequence</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:0001583}\">missense_variant</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.ncbi.nlm.nih.gov/refseq NM_000540.2}\">NM_000540.2</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.2151 relative frequency of a particular allele in the specimen</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 93.0 reads per base pair</p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:10483",
"display" : "RYR1"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.4964G>A",
"display" : "c.4964G>A"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.R1655H",
"display" : "p.R1655H"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes",
"code" : "molecular-consequence",
"display" : "Molecular Consequence"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_000540.2",
"display" : "NM_000540.2"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "G"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.2151,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 93.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p></p><p><b>category</b>: <span title=\"Codes: {http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"#urnuuidf7a438e6-f484-453d-97e8-aa4d51008648\">See above (Patient/null)</a></p><p><b>performer</b>: <a href=\"#urnuuidfc16d84c-8584-4e1d-baae-64e2f95bfe17\">See above (Organization/null)</a></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes: {http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: <span></span></p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.genenames.org/geneId HGNC:10519}\">SACS</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org c.12118G>A}\">c.12118G>A</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org p.A4040T}\">p.A4040T</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes molecular-consequence}\">Molecular Consequence</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:0001583}\">missense_variant</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.ncbi.nlm.nih.gov/refseq NM_014363.5}\">NM_014363.5</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.3333 relative frequency of a particular allele in the specimen</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 60.0 reads per base pair</p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:10519",
"display" : "SACS"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.12118G>A",
"display" : "c.12118G>A"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.A4040T",
"display" : "p.A4040T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes",
"code" : "molecular-consequence",
"display" : "Molecular Consequence"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_014363.5",
"display" : "NM_014363.5"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "C"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.3333,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 60.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p></p><p><b>category</b>: <span title=\"Codes: {http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"#urnuuidf7a438e6-f484-453d-97e8-aa4d51008648\">See above (Patient/null)</a></p><p><b>performer</b>: <a href=\"#urnuuidfc16d84c-8584-4e1d-baae-64e2f95bfe17\">See above (Organization/null)</a></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes: {http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: <span></span></p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.genenames.org/geneId HGNC:11086}\">SLIT2</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org c.1290C>A}\">c.1290C>A</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org p.N430K}\">p.N430K</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes molecular-consequence}\">Molecular Consequence</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:0001583}\">missense_variant</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.ncbi.nlm.nih.gov/refseq NM_004787.3}\">NM_004787.3</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.2642 relative frequency of a particular allele in the specimen</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 53.0 reads per base pair</p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:11086",
"display" : "SLIT2"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.1290C>A",
"display" : "c.1290C>A"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.N430K",
"display" : "p.N430K"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes",
"code" : "molecular-consequence",
"display" : "Molecular Consequence"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_004787.3",
"display" : "NM_004787.3"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "C"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.2642,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 53.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca",
"resource" : {
"resourceType" : "Observation",
"meta" : {
"profile" : [
"http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p></p><p><b>category</b>: <span title=\"Codes: {http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"#urnuuidf7a438e6-f484-453d-97e8-aa4d51008648\">See above (Patient/null)</a></p><p><b>performer</b>: <a href=\"#urnuuidfc16d84c-8584-4e1d-baae-64e2f95bfe17\">See above (Organization/null)</a></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes: {http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: <span></span></p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.genenames.org/geneId HGNC:11100}\">SMARCA4</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes: {http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org c.2372C>T}\">c.2372C>T</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes: {http://varnomen.hgvs.org p.A791V}\">p.A791V</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes molecular-consequence}\">Molecular Consequence</span></p><p><b>value</b>: <span title=\"Codes: {http://www.sequenceontology.org SO:0001583}\">missense_variant</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes: {http://www.ncbi.nlm.nih.gov/refseq NM_001128849.1}\">NM_001128849.1</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.1938 relative frequency of a particular allele in the specimen</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 160.0 reads per base pair</p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org/geneId",
"code" : "HGNC:11100",
"display" : "SMARCA4"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "c.2372C>T",
"display" : "c.2372C>T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "p.A791V",
"display" : "p.A791V"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/TbdCodes",
"code" : "molecular-consequence",
"display" : "Molecular Consequence"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.sequenceontology.org",
"code" : "SO:0001583",
"display" : "missense_variant"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_001128849.1",
"display" : "NM_001128849.1"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "C"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.1938,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 160.0,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "{reads}/{base}"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:6a80003f-822d-489e-8286-1f1dcba56dfa",
"resource" : {
"resourceType" : "DiagnosticReport",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>identifier</b>: id: 42867</p><p><b>status</b>: final</p><p><b>category</b>: <span title=\"Codes: {http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes: {http://loinc.org 81247-9}\">Master HL7 genetic variant reporting panel</span></p><p><b>subject</b>: <a href=\"#urnuuidf7a438e6-f484-453d-97e8-aa4d51008648\">See above (Patient/null)</a></p><p><b>issued</b>: Sep 15, 2019 3:35:05 PM</p><p><b>performer</b>: <a href=\"#urnuuidfc16d84c-8584-4e1d-baae-64e2f95bfe17\">See above (Organization/null)</a></p><p><b>specimen</b>: <a href=\"#urnuuida2041c83-b73d-4fc8-9466-4ba4a92da516\">See above (Specimen/null)</a></p><p><b>result</b>: </p><ul><li><a href=\"#urnuuiddac358c3-403a-4dbb-b478-4259aed882ae\">See above (Observation/null)</a></li><li><a href=\"#urnuuid1d773d66-cec7-44a2-b92a-46d00adeae00\">See above (Observation/null)</a></li><li><a href=\"#urnuuid842d9ab9-d940-4f0c-adf9-e5c528f5c0e5\">See above (Observation/null)</a></li><li><a href=\"#urnuuid9a9f9a4a-52e3-4738-bd0b-a25374bbf358\">See above (Observation/null)</a></li><li><a href=\"#urnuuid58828523-8893-45fc-973b-16290366c5e5\">See above (Observation/null)</a></li><li><a href=\"#urnuuid2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2\">See above (Observation/null)</a></li><li><a href=\"#urnuuid41bebbe5-e06f-4867-aa22-7c06db69dbd1\">See above (Observation/null)</a></li><li><a href=\"#urnuuid1642f190-e2c6-4999-8040-b9b2a70618bf\">See above (Observation/null)</a></li><li><a href=\"#urnuuidc3587931-242f-4129-93f9-be24500c8f29\">See above (Observation/null)</a></li><li><a href=\"#urnuuid41695fc0-1fd5-4cc8-95e6-82b2848a5cb6\">See above (Observation/null)</a></li><li><a href=\"#urnuuid58eb14f6-4059-4168-86a9-155ae61d30e2\">See above (Observation/null)</a></li><li><a href=\"#urnuuid1a71e80f-b044-4a91-80e1-eadbe5a53dca\">See above (Observation/null)</a></li></ul></div>"
},
"identifier" : [
{
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/reportID",
"value" : "42867"
}
],
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE",
"display" : "Genetics"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81247-9",
"display" : "Master HL7 genetic variant reporting panel"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"issued" : "2019-09-15T11:35:05.722-04:00",
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"specimen" : [
{
"reference" : "urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516"
}
],
"result" : [
{
"reference" : "urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae"
},
{
"reference" : "urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00"
},
{
"reference" : "urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5"
},
{
"reference" : "urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358"
},
{
"reference" : "urn:uuid:58828523-8893-45fc-973b-16290366c5e5"
},
{
"reference" : "urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2"
},
{
"reference" : "urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1"
},
{
"reference" : "urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf"
},
{
"reference" : "urn:uuid:c3587931-242f-4129-93f9-be24500c8f29"
},
{
"reference" : "urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6"
},
{
"reference" : "urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2"
},
{
"reference" : "urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca"
}
]
},
"request" : {
"method" : "POST",
"url" : "DiagnosticReport"
}
}
]
}
IG © 2019+ HL7 International Clinical Genomics Work Group. Package hl7.fhir.uv.genomics-reporting#1.1.0 based on FHIR 4.0.1. Generated 2021-04-13
Links: Table of Contents |
QA Report
| Version History |
Search |
|
Propose a change