R6 Ballot (2nd Draft)

This page is part of the FHIR Specification v6.0.0-ballot2: Release 6 Ballot (2nd Draft) (see Ballot Notes). The current version is 5.0.0. For a full list of available versions, see the Directory of published versions

Example MolecularDefinition/example-sequence2-2b-concatenated (XML)

Clinical Genomics Work GroupMaturity Level: N/AStandards Status: InformativeCompartments: No defined compartments

Raw XML (canonical form + also see XML Format Specification)

Simple Sequence example 2 to be concatenated (id = "example-sequence2-2b-concatenated")

<?xml version="1.0" encoding="UTF-8"?>

<MolecularDefinition xmlns="http://hl7.org/fhir">
  <id value="example-sequence2-2b-concatenated"/> 
  <meta> 
    <profile value="http://hl7.org/fhir/StructureDefinition/sequence"/> 
  </meta> 
  <type value="dna"/> 
  <representation> 
    <literal> 
      <value value="TTTTCAAATCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGTCCTTAAAGAAAC AAAGTCCAAAAGTCACTTTTGA
      ATGTGAACAAAAGGAAGAAAATCAAGGAAAGAATGAGTCTAATATCAA GCCTGTACAGACAGTTAATATCACTGCAGGCTTTCCTGTGGTTGG
      TCAGAAAGA"/> 
    </literal> 
  </representation> 
</MolecularDefinition> 

Usage note: every effort has been made to ensure that the examples are correct and useful, but they are not a normative part of the specification.