R6 Ballot (2nd Draft)

This page is part of the FHIR Specification v6.0.0-ballot2: Release 6 Ballot (2nd Draft) (see Ballot Notes). The current version is 5.0.0. For a full list of available versions, see the Directory of published versions

Example MolecularDefinition/example-sequence2-2b-concatenated (Turtle)

Clinical Genomics Work GroupMaturity Level: N/AStandards Status: InformativeCompartments: No defined compartments

Raw Turtle (+ also see Turtle/RDF Format Specification)

Simple Sequence example 2 to be concatenated

@prefix fhir: <http://hl7.org/fhir/> .
@prefix owl: <http://www.w3.org/2002/07/owl#> .
@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
@prefix xsd: <http://www.w3.org/2001/XMLSchema#> .

# - resource -------------------------------------------------------------------

[a fhir:MolecularDefinition ;
  fhir:nodeRole fhir:treeRoot ;
  fhir:id [ fhir:v "example-sequence2-2b-concatenated"] ; # 
  fhir:meta [
     fhir:profile ( [
       fhir:v "http://hl7.org/fhir/StructureDefinition/sequence"^^xsd:anyURI ;
       fhir:link <http://hl7.org/fhir/StructureDefinition/sequence>
     ] )
  ] ; # 
  fhir:type [ fhir:v "dna"] ; # 
  fhir:representation ( [
     fhir:literal [
       fhir:value [ fhir:v "TTTTCAAATCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGTCCTTAAAGAAAC AAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGGAAGAAAATCAAGGAAAGAATGAGTCTAATATCAA GCCTGTACAGACAGTTAATATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGA" ]
     ]
  ] )] . # 

# -------------------------------------------------------------------------------------


Usage note: every effort has been made to ensure that the examples are correct and useful, but they are not a normative part of the specification.