This page is part of the FHIR Specification v6.0.0-ballot2: Release 6 Ballot (2nd Draft) (see Ballot Notes). The current version is 5.0.0. For a full list of available versions, see the Directory of published versions 
Example MolecularDefinition/example-sequence2-2b-concatenated (Turtle)
Raw Turtle (+ also see Turtle/RDF Format Specification)
Simple Sequence example 2 to be concatenated
@prefix fhir: <http://hl7.org/fhir/> .
@prefix owl: <http://www.w3.org/2002/07/owl#> .
@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
@prefix xsd: <http://www.w3.org/2001/XMLSchema#> .
# - resource -------------------------------------------------------------------
[a fhir:MolecularDefinition ;
fhir:nodeRole fhir:treeRoot ;
fhir:id [ fhir:v "example-sequence2-2b-concatenated"] ; #
fhir:meta [
fhir:profile ( [
fhir:v "http://hl7.org/fhir/StructureDefinition/sequence"^^xsd:anyURI ;
fhir:link <http://hl7.org/fhir/StructureDefinition/sequence>
] )
] ; #
fhir:type [ fhir:v "dna"] ; #
fhir:representation ( [
fhir:literal [
fhir:value [ fhir:v "TTTTCAAATCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGTCCTTAAAGAAAC AAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGGAAGAAAATCAAGGAAAGAATGAGTCTAATATCAA GCCTGTACAGACAGTTAATATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGA" ]
]
] )] . #
# -------------------------------------------------------------------------------------
Usage note: every effort has been made to ensure that the
examples are correct and useful, but they are not a normative part
of the specification.