R6 Ballot (2nd Draft)

This page is part of the FHIR Specification v6.0.0-ballot2: Release 6 Ballot (2nd Draft) (see Ballot Notes). The current version is 5.0.0. For a full list of available versions, see the Directory of published versions

Example MolecularDefinition/example-sequence2-2b-concatenated (Narrative)

Clinical Genomics Work GroupMaturity Level: N/AStandards Status: InformativeCompartments: No defined compartments

This is the narrative for the resource. See also the XML, JSON or Turtle format. This example conforms to the profile MolecularDefinition.


Generated Narrative: MolecularDefinition example-sequence2-2b-concatenated

type: dna

representation

Literals

-Value
* TTTTCAAATCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGTCCTTAAAGAAAC AAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGGAAGAAAATCAAGGAAAGAATGAGTCTAATATCAA GCCTGTACAGACAGTTAATATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGA

 

 

Usage note: every effort has been made to ensure that the examples are correct and useful, but they are not a normative part of the specification.