This page is part of the Genetic Reporting Implementation Guide (v0.1.0: STU 1 Ballot 1) based on FHIR v3.3.0. The current version which supercedes this version is 2.0.0. For a full list of available versions, see the Directory of published versions

(back to narrative)

Raw ttl

@prefix fhir: <http://hl7.org/fhir/> .
@prefix loinc: <http://loinc.org/rdf#> .
@prefix owl: <http://www.w3.org/2002/07/owl#> .
@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
@prefix sct: <http://snomed.info/id/> .
@prefix xsd: <http://www.w3.org/2001/XMLSchema#> .

# - resource -------------------------------------------------------------------

 a fhir:Bundle;
  fhir:nodeRole fhir:treeRoot;
  fhir:Resource.id [ fhir:value "CG-IG-HLA-FullBundle-01"];
  fhir:Bundle.type [ fhir:value "transaction"];
  fhir:Bundle.entry [
     fhir:index 0;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
     fhir:Bundle.entry.resource <urn:uuid:13f34265-335c-4853-bc38-0815315edafa>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Patient" ]     ]
  ], [
     fhir:index 1;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
     fhir:Bundle.entry.resource <urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Specimen" ]     ]
  ], [
     fhir:index 2;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ];
     fhir:Bundle.entry.resource <urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Organization" ]     ]
  ], [
     fhir:index 3;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5" ];
     fhir:Bundle.entry.resource <urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Organization" ]     ]
  ], [
     fhir:index 4;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ];
     fhir:Bundle.entry.resource <urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "ServiceRequest" ]     ]
  ], [
     fhir:index 5;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804" ];
     fhir:Bundle.entry.resource <urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]     ]
  ], [
     fhir:index 6;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675" ];
     fhir:Bundle.entry.resource <urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]     ]
  ], [
     fhir:index 7;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621" ];
     fhir:Bundle.entry.resource <urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]     ]
  ], [
     fhir:index 8;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0" ];
     fhir:Bundle.entry.resource <urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]     ]
  ], [
     fhir:index 9;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6" ];
     fhir:Bundle.entry.resource <urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 10;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32" ];
     fhir:Bundle.entry.resource <urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 11;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228" ];
     fhir:Bundle.entry.resource <urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 12;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670" ];
     fhir:Bundle.entry.resource <urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]     ]
  ], [
     fhir:index 13;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138" ];
     fhir:Bundle.entry.resource <urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]     ]
  ], [
     fhir:index 14;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe" ];
     fhir:Bundle.entry.resource <urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]     ]
  ], [
     fhir:index 15;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309" ];
     fhir:Bundle.entry.resource <urn:uuid:db69e549-6267-4777-b4b9-8813f3329309>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]     ]
  ], [
     fhir:index 16;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a" ];
     fhir:Bundle.entry.resource <urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 17;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5" ];
     fhir:Bundle.entry.resource <urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 18;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70" ];
     fhir:Bundle.entry.resource <urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 19;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0" ];
     fhir:Bundle.entry.resource <urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]     ]
  ], [
     fhir:index 20;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f" ];
     fhir:Bundle.entry.resource <urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]     ]
  ], [
     fhir:index 21;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce" ];
     fhir:Bundle.entry.resource <urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]     ]
  ], [
     fhir:index 22;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9" ];
     fhir:Bundle.entry.resource <urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]     ]
  ], [
     fhir:index 23;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:709c5315-9403-4867-9d82-0b953836665f" ];
     fhir:Bundle.entry.resource <urn:uuid:709c5315-9403-4867-9d82-0b953836665f>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 24;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47" ];
     fhir:Bundle.entry.resource <urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 25;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208" ];
     fhir:Bundle.entry.resource <urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]     ]
  ], [
     fhir:index 26;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9" ];
     fhir:Bundle.entry.resource <urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "DiagnosticReport" ]     ]
  ].

<urn:uuid:13f34265-335c-4853-bc38-0815315edafa> a fhir:Patient;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <h4>Donor </h4>\n            <p>name: John Storm</p>\n            <p>gender: male</p>\n            <p>born: 1986-12-31</p>\n          </div>"
  ];
  fhir:Patient.identifier [
     fhir:index 0;
     fhir:Identifier.use [ fhir:value "usual" ];
     fhir:Identifier.type [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://hl7.org/fhir/v2/0203" ];
         fhir:Coding.code [ fhir:value "DR" ]       ]     ];
     fhir:Identifier.system [ fhir:value "urn:oid:0.0.0.0.0.0.0" ];
     fhir:Identifier.value [ fhir:value "12345" ];
     fhir:Identifier.period [
       fhir:Period.start [ fhir:value "2012-11-10"^^xsd:date ]     ];
     fhir:Identifier.assigner [
       fhir:Reference.display [ fhir:value "aDonorRegistry" ]     ]
  ];
  fhir:Patient.name [
     fhir:index 0;
     fhir:HumanName.use [ fhir:value "official" ];
     fhir:HumanName.text [ fhir:value "John Storm" ];
     fhir:HumanName.family [ fhir:value "Storm" ];
     fhir:HumanName.given [
       fhir:value "John";
       fhir:index 0     ]
  ], [
     fhir:index 1;
     fhir:HumanName.use [ fhir:value "nickname" ];
     fhir:HumanName.text [ fhir:value "Johnny Storm" ];
     fhir:HumanName.family [ fhir:value "Storm" ];
     fhir:HumanName.given [
       fhir:value "Johnny";
       fhir:index 0     ]
  ], [
     fhir:index 2;
     fhir:HumanName.use [ fhir:value "nickname" ];
     fhir:HumanName.text [ fhir:value "The Human Torch" ]
  ];
  fhir:Patient.gender [ fhir:value "male"];
  fhir:Patient.birthDate [ fhir:value "1986-12-31"^^xsd:date].

<urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340> a fhir:Specimen;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>a buccal swab</pre>\n          </div>"
  ];
  fhir:Specimen.identifier [
     fhir:index 0;
     fhir:Identifier.system [ fhir:value "http://myorgsurl.com" ];
     fhir:Identifier.value [ fhir:value "123" ]
  ];
  fhir:Specimen.accessionIdentifier [
     fhir:Identifier.system [ fhir:value "http://mylabsurl.com" ];
     fhir:Identifier.value [ fhir:value "456" ]
  ];
  fhir:Specimen.type [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a sct:258564008;
       fhir:Coding.system [ fhir:value "http://snomed.info/sct" ];
       fhir:Coding.code [ fhir:value "258564008" ];
       fhir:Coding.display [ fhir:value "Buccal smear sample" ]     ]
  ];
  fhir:Specimen.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
     fhir:Reference.type [ fhir:value "Patient" ];
     fhir:Reference.display [ fhir:value "John Storm" ]
  ];
  fhir:Specimen.collection [
     fhir:Specimen.collection.collectedDateTime [ fhir:value "2016-11-10"^^xsd:date ];
     fhir:Specimen.collection.method [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://hl7.org/fhir/v2/0488" ];
         fhir:Coding.code [ fhir:value "SWA" ]       ]     ];
     fhir:Specimen.collection.bodySite [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a sct:261063000;
         fhir:Coding.system [ fhir:value "http://snomed.info/sct" ];
         fhir:Coding.code [ fhir:value "261063000" ];
         fhir:Coding.display [ fhir:value "Buccal space" ]       ];
       fhir:CodeableConcept.text [ fhir:value "Buccal space" ]     ]
  ].

<urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950> a fhir:Organization;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>aTypingLab, Inc</pre>\n          </div>"
  ];
  fhir:Organization.name [ fhir:value "aTypingLab Inc"];
  fhir:Organization.alias [
     fhir:value "aTL";
     fhir:index 0
  ];
  fhir:Organization.telecom [
     fhir:index 0;
     fhir:ContactPoint.system [ fhir:value "phone" ];
     fhir:ContactPoint.value [ fhir:value "1-800-555-1234" ];
     fhir:ContactPoint.use [ fhir:value "work" ];
     fhir:ContactPoint.rank [ fhir:value "1"^^xsd:positiveInteger ]
  ];
  fhir:Organization.address [
     fhir:index 0;
     fhir:Address.use [ fhir:value "work" ];
     fhir:Address.type [ fhir:value "both" ];
     fhir:Address.text [ fhir:value "123 Main St, Sometown, ND 99999" ];
     fhir:Address.line [
       fhir:value "123 Main St";
       fhir:index 0     ];
     fhir:Address.city [ fhir:value "Sometown" ];
     fhir:Address.state [ fhir:value "ND" ];
     fhir:Address.postalCode [ fhir:value "99999" ];
     fhir:Address.country [ fhir:value "USA" ]
  ].

<urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5> a fhir:Organization;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>aDonorRegistry</pre>\n          </div>"
  ];
  fhir:Organization.name [ fhir:value "aDonorRegistry"];
  fhir:Organization.alias [
     fhir:value "ADR";
     fhir:index 0
  ];
  fhir:Organization.telecom [
     fhir:index 0;
     fhir:ContactPoint.system [ fhir:value "phone" ];
     fhir:ContactPoint.value [ fhir:value "1-800-555-6789" ];
     fhir:ContactPoint.use [ fhir:value "work" ];
     fhir:ContactPoint.rank [ fhir:value "1"^^xsd:positiveInteger ]
  ];
  fhir:Organization.address [
     fhir:index 0;
     fhir:Address.use [ fhir:value "work" ];
     fhir:Address.type [ fhir:value "both" ];
     fhir:Address.text [ fhir:value "456 Main St, Anytown ND, 00000" ];
     fhir:Address.line [
       fhir:value "456 Main St";
       fhir:index 0     ];
     fhir:Address.city [ fhir:value "Anytown" ];
     fhir:Address.state [ fhir:value "ND" ];
     fhir:Address.postalCode [ fhir:value "00000" ];
     fhir:Address.country [ fhir:value "USA" ]
  ].

<urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea> a fhir:ServiceRequest;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>HLA typing request for John Storm</pre>\n          </div>"
  ];
  fhir:ServiceRequest.status [ fhir:value "completed"];
  fhir:ServiceRequest.intent [ fhir:value "order"];
  fhir:ServiceRequest.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:13303-3;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "13303-3" ];
       fhir:Coding.display [ fhir:value "HLA-A+​B+​C (class I) [Type]" ]     ]
  ];
  fhir:ServiceRequest.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
     fhir:Reference.type [ fhir:value "Patient" ];
     fhir:Reference.display [ fhir:value "John Storm" ]
  ];
  fhir:ServiceRequest.authoredOn [ fhir:value "2016-11-15"^^xsd:date];
  fhir:ServiceRequest.requester [
     fhir:Reference.reference [ fhir:value "urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5" ];
     fhir:Reference.type [ fhir:value "Organization" ];
     fhir:Reference.display [ fhir:value "aDonorRegistry" ]
  ];
  fhir:ServiceRequest.performer [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ];
     fhir:Reference.type [ fhir:value "Organization" ];
     fhir:Reference.display [ fhir:value "aTypingLab, Inc" ]
  ];
  fhir:ServiceRequest.reasonCode [
     fhir:index 0;
     fhir:CodeableConcept.text [ fhir:value "tissue typing for donor registry" ]
  ].

<urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>&quot;HLA-A*01:01:01:01, exon 2&quot;</pre>\n          </div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00001" ]       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-A*01:01:01:01" ]     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "503"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "773"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"].

<urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>&quot;HLA-A*01:01:01:01, exon 3&quot;</pre>\n          </div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00001" ]       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-A*01:01:01:01" ]     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "1014"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1290"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"].

<urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>&quot;HLA-A*01:02, exon 2&quot;</pre>\n          </div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00002" ]       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-A*01:02" ]     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "503"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "773"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTCCACATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"].

<urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>&quot;HLA-A*01:02, exon 3&quot;</pre>\n          </div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00002" ]       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-A*01:02" ]     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "1014"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1290"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"].

<urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>HLA-A:01:01:01G</pre>\n          </div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://hl7.org/fhir/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:84414-2;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "84414-2" ];
       fhir:Coding.display [ fhir:value "Haplotype name" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
     fhir:Reference.type [ fhir:value "Patient" ];
     fhir:Reference.display [ fhir:value "John Storm" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
       fhir:Coding.version [ fhir:value "3.23" ];
       fhir:Coding.code [ fhir:value "HGG00001" ];
       fhir:Coding.display [ fhir:value "HLA-A*01:01:01G" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ];
       fhir:Coding.code [ fhir:value "GTR000000000.0" ]     ];
     fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
     fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804" ];
     fhir:Reference.type [ fhir:value "Sequence" ];
     fhir:Reference.display [ fhir:value "HLA-A*01:01:01:01, exon 2" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675" ];
     fhir:Reference.type [ fhir:value "Sequence" ];
     fhir:Reference.display [ fhir:value "HLA-A*01:01:01:01, exon 3" ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene Studied" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "https://www.genenames.org/" ];
         fhir:Coding.code [ fhir:value "HGNC:4931" ];
         fhir:Coding.display [ fhir:value "HLA-A" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81293-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81293-3" ];
         fhir:Coding.display [ fhir:value "Description of ranges of DNA sequences examined" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.text [ fhir:value "Exons 2 and 3" ]     ]
  ].

<urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>HLA-A*01:02</pre>\n          </div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://hl7.org/fhir/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:84414-2;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "84414-2" ];
       fhir:Coding.display [ fhir:value "Haplotype name" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
     fhir:Reference.type [ fhir:value "Patient" ];
     fhir:Reference.display [ fhir:value "John Storm" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
       fhir:Coding.version [ fhir:value "3.23" ];
       fhir:Coding.code [ fhir:value "HLA00002" ];
       fhir:Coding.display [ fhir:value "HLA-A*01:02" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ];
       fhir:Coding.code [ fhir:value "GTR000000000.0" ]     ];
     fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
     fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621" ];
     fhir:Reference.type [ fhir:value "Sequence" ];
     fhir:Reference.display [ fhir:value "HLA-A*01:02, exon 2" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0" ];
     fhir:Reference.type [ fhir:value "Sequence" ];
     fhir:Reference.display [ fhir:value "HLA-A*01:02, exon 3" ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene Studied" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "https://www.genenames.org/" ];
         fhir:Coding.code [ fhir:value "HGNC:4931" ];
         fhir:Coding.display [ fhir:value "HLA-A" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81293-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81293-3" ];
         fhir:Coding.display [ fhir:value "Description of ranges of DNA sequences examined" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.text [ fhir:value "Exons 2 and 3" ]     ]
  ].

<urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-genotype";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-genotype>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>HLA-A:01:01G+HLA-A*01:02</pre>\n          </div>"
  ];
  fhir:Observation.basedOn [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ];
     fhir:Reference.type [ fhir:value "ServiceRequest" ];
     fhir:Reference.display [ fhir:value "Class I HLA genotyping for John Storm" ]
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://hl7.org/fhir/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:84413-4;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "84413-4" ];
       fhir:Coding.display [ fhir:value "Genotype display name" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
     fhir:Reference.type [ fhir:value "Patient" ];
     fhir:Reference.display [ fhir:value "John Storm" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.text [ fhir:value "HLA-A:01:01G+HLA-A*01:02" ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ];
       fhir:Coding.code [ fhir:value "GTR000000000.0" ]     ];
     fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
     fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6" ];
     fhir:Reference.type [ fhir:value "Observation" ];
     fhir:Reference.display [ fhir:value "HLA-A*01:01:01G, exons 2 and 3" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32" ];
     fhir:Reference.type [ fhir:value "Observation" ];
     fhir:Reference.display [ fhir:value "HLA-A*01:02, exons 2 and 3" ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene Studied" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "https://www.genenames.org/" ];
         fhir:Coding.code [ fhir:value "HGNC:4931" ];
         fhir:Coding.display [ fhir:value "HLA-A" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81293-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81293-3" ];
         fhir:Coding.display [ fhir:value "Description of ranges of DNA sequences examined" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.text [ fhir:value "Exons 2 and 3" ]     ]
  ].

<urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>&quot;HLA-B*15:01:01:01, exon 2&quot;</pre>\n          </div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00162" ]       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-B*15:01:01:01" ]     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "486"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "756"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"].

<urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>&quot;HLA-B*15:01:01:01, exon 3&quot;</pre>\n          </div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00162" ]       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-B*15:01:01:01" ]     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "1001"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1277"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGTGGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"].

<urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>&quot;HLA-B*57:01:01, exon 2&quot;</pre>\n          </div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00381" ]       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-B*57:01:01" ]     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "485"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "755"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGAAGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG"].

<urn:uuid:db69e549-6267-4777-b4b9-8813f3329309> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>&quot;HLA-B*57:01:01, exon 3&quot;</pre>\n          </div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00381" ]       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-B*57:01:01" ]     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "1001"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1277"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"].

<urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>HLA-B*15:01:01G</pre>\n          </div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://hl7.org/fhir/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:84414-2;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "84414-2" ];
       fhir:Coding.display [ fhir:value "Haplotype name" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
     fhir:Reference.type [ fhir:value "Patient" ];
     fhir:Reference.display [ fhir:value "John Storm" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
       fhir:Coding.version [ fhir:value "3.23" ];
       fhir:Coding.code [ fhir:value "HGG00041" ];
       fhir:Coding.display [ fhir:value "HLA-B*15:01:01G" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ];
       fhir:Coding.code [ fhir:value "GTR000000000.0" ]     ];
     fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
     fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670" ];
     fhir:Reference.type [ fhir:value "Sequence" ];
     fhir:Reference.display [ fhir:value "HLA-B*15:01:01:01, exon 2" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138" ];
     fhir:Reference.type [ fhir:value "Sequence" ];
     fhir:Reference.display [ fhir:value "HLA-B*15:01:01:01, exon 3" ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene Studied" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "https://www.genenames.org/" ];
         fhir:Coding.code [ fhir:value "HGNC:4932" ];
         fhir:Coding.display [ fhir:value "HLA-B" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81293-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81293-3" ];
         fhir:Coding.display [ fhir:value "Description of ranges of DNA sequences examined" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.text [ fhir:value "Exons 2 and 3" ]     ]
  ].

<urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>HLA-B*57:01:01G</pre>\n          </div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://hl7.org/fhir/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:84414-2;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "84414-2" ];
       fhir:Coding.display [ fhir:value "Haplotype name" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
     fhir:Reference.type [ fhir:value "Patient" ];
     fhir:Reference.display [ fhir:value "John Storm" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
       fhir:Coding.version [ fhir:value "3.23" ];
       fhir:Coding.code [ fhir:value "HGG00079" ];
       fhir:Coding.display [ fhir:value "HLA-B*57:01:01G" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ];
       fhir:Coding.code [ fhir:value "GTR000000000.0" ]     ];
     fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
     fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe" ];
     fhir:Reference.type [ fhir:value "Sequence" ];
     fhir:Reference.display [ fhir:value "HLA-B*57:01:01, exon 2" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309" ];
     fhir:Reference.type [ fhir:value "Sequence" ];
     fhir:Reference.display [ fhir:value "HLA-B*57:01:01, exon 3" ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene Studied" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "https://www.genenames.org/" ];
         fhir:Coding.code [ fhir:value "HGNC:4932" ];
         fhir:Coding.display [ fhir:value "HLA-B" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81293-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81293-3" ];
         fhir:Coding.display [ fhir:value "Description of ranges of DNA sequences examined" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.text [ fhir:value "Exons 2 and 3" ]     ]
  ].

<urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-genotype";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-genotype>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>HLA-B*15:01:01G+HLA-B*57:01:01G</pre>\n          </div>"
  ];
  fhir:Observation.basedOn [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ];
     fhir:Reference.type [ fhir:value "ServiceRequest" ];
     fhir:Reference.display [ fhir:value "Class I HLA genotyping for John Storm" ]
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://hl7.org/fhir/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:84413-4;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "84413-4" ];
       fhir:Coding.display [ fhir:value "Genotype display name" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
     fhir:Reference.type [ fhir:value "Patient" ];
     fhir:Reference.display [ fhir:value "John Storm" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.text [ fhir:value "HLA-B*15:01:01G+HLA-B*57:01:01G" ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ];
       fhir:Coding.code [ fhir:value "GTR000000000.0" ]     ];
     fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
     fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a" ];
     fhir:Reference.type [ fhir:value "Observation" ];
     fhir:Reference.display [ fhir:value "HLA-B*15:01:01G, exons 2 and 3" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5" ];
     fhir:Reference.type [ fhir:value "Observation" ];
     fhir:Reference.display [ fhir:value "HLA-B*57:01:01G, exons 2 and 3" ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene Studied" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "https://www.genenames.org/" ];
         fhir:Coding.code [ fhir:value "HGNC:4932" ];
         fhir:Coding.display [ fhir:value "HLA-B" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81293-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81293-3" ];
         fhir:Coding.display [ fhir:value "Description of ranges of DNA sequences examined" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.text [ fhir:value "Exons 2 and 3" ]     ]
  ].

<urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>&quot;HLA-C*01:02:01, exon 2&quot;</pre>\n          </div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00401" ]       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-C*01:02:01" ]     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "486"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "756"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAAGTATTTCTTCACATCCGTGTCCCGGCCTGGCCGCGGAGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"].

<urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>&quot;HLA-C*01:02:01, exon 3&quot;</pre>\n          </div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00401" ]       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-C*01:02:01" ]     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "1002"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1278"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GGTCTCACACCCTCCAGTGGATGTGTGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"].

<urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>&quot;HLA-C*03:04:01:01, exon 2&quot;</pre>\n          </div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00413" ]       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-C*03:04:01:01" ]     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "486"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "756"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"].

<urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>&quot;HLA-C*03:04:01:01, exon 3&quot;</pre>\n          </div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00413" ]       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-C*03:04:01:01" ]     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "1001"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1277"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGG"].

<urn:uuid:709c5315-9403-4867-9d82-0b953836665f> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>HLA-C*01:02:01G</pre>\n          </div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://hl7.org/fhir/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:84414-2;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "84414-2" ];
       fhir:Coding.display [ fhir:value "Haplotype name" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
     fhir:Reference.type [ fhir:value "Patient" ];
     fhir:Reference.display [ fhir:value "John Storm" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
       fhir:Coding.version [ fhir:value "3.23" ];
       fhir:Coding.code [ fhir:value "HGG00083" ];
       fhir:Coding.display [ fhir:value "HLA-C*01:02:01G" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ];
       fhir:Coding.code [ fhir:value "GTR000000000.0" ]     ];
     fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
     fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0" ];
     fhir:Reference.type [ fhir:value "Sequence" ];
     fhir:Reference.display [ fhir:value "HLA-C*01:02:01, exon 2" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f" ];
     fhir:Reference.type [ fhir:value "Sequence" ];
     fhir:Reference.display [ fhir:value "HLA-C*01:02:01, exon 3" ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene Studied" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "https://www.genenames.org/" ];
         fhir:Coding.code [ fhir:value "HGNC:4933" ];
         fhir:Coding.display [ fhir:value "HLA-C" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81293-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81293-3" ];
         fhir:Coding.display [ fhir:value "Description of ranges of DNA sequences examined" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.text [ fhir:value "Exons 2 and 3" ]     ]
  ].

<urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>HLA-C*03:04:01G</pre>\n          </div>"
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://hl7.org/fhir/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:84414-2;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "84414-2" ];
       fhir:Coding.display [ fhir:value "Haplotype name" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
     fhir:Reference.type [ fhir:value "Patient" ];
     fhir:Reference.display [ fhir:value "John Storm" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
       fhir:Coding.version [ fhir:value "3.23" ];
       fhir:Coding.code [ fhir:value "HGG00088" ];
       fhir:Coding.display [ fhir:value "HLA-C*01:02:01G" ]     ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ];
       fhir:Coding.code [ fhir:value "GTR000000000.0" ]     ];
     fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
     fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce" ];
     fhir:Reference.type [ fhir:value "Sequence" ];
     fhir:Reference.display [ fhir:value "HLA-C*03:04:01:01, exon 2" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9" ];
     fhir:Reference.type [ fhir:value "Sequence" ];
     fhir:Reference.display [ fhir:value "HLA-C*03:04:01:01, exon 3" ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene Studied" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "https://www.genenames.org/" ];
         fhir:Coding.code [ fhir:value "HGNC:4933" ];
         fhir:Coding.display [ fhir:value "HLA-C" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81293-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81293-3" ];
         fhir:Coding.display [ fhir:value "Description of ranges of DNA sequences examined" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.text [ fhir:value "Exons 2 and 3" ]     ]
  ].

<urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208> a fhir:Observation;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-genotype";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-genotype>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>HLA-C*01:02:01G+HLA-C*03:04:01G</pre>\n          </div>"
  ];
  fhir:Observation.basedOn [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ];
     fhir:Reference.type [ fhir:value "ServiceRequest" ];
     fhir:Reference.display [ fhir:value "Class I HLA genotyping for John Storm" ]
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.category [
     fhir:index 0;
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://hl7.org/fhir/observation-category" ];
       fhir:Coding.code [ fhir:value "laboratory" ]     ]
  ];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:84413-4;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "84413-4" ];
       fhir:Coding.display [ fhir:value "Genotype display name" ]     ]
  ];
  fhir:Observation.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
     fhir:Reference.type [ fhir:value "Patient" ];
     fhir:Reference.display [ fhir:value "John Storm" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.valueCodeableConcept [
     fhir:CodeableConcept.text [ fhir:value "HLA-C*01:02:01G+HLA-C*03:04:01G" ]
  ];
  fhir:Observation.method [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ];
       fhir:Coding.code [ fhir:value "GTR000000000.0" ]     ];
     fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ]
  ];
  fhir:Observation.specimen [
     fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
     fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47" ];
     fhir:Reference.type [ fhir:value "Observation" ];
     fhir:Reference.display [ fhir:value "HLA-C*03:04:01G, exons 2 and 3" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:709c5315-9403-4867-9d82-0b953836665f" ];
     fhir:Reference.type [ fhir:value "Observation" ];
     fhir:Reference.display [ fhir:value "HLA-C*01:02:01G, exons 2 and 3" ]
  ];
  fhir:Observation.component [
     fhir:index 0;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:48018-6;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "48018-6" ];
         fhir:Coding.display [ fhir:value "Gene Studied" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "https://www.genenames.org/" ];
         fhir:Coding.code [ fhir:value "HGNC:4933" ];
         fhir:Coding.display [ fhir:value "HLA-C" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Observation.component.code [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:81293-3;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "81293-3" ];
         fhir:Coding.display [ fhir:value "Description of ranges of DNA sequences examined" ]       ]     ];
     fhir:Observation.component.valueCodeableConcept [
       fhir:CodeableConcept.text [ fhir:value "Exons 2 and 3" ]     ]
  ].

<urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9> a fhir:DiagnosticReport;
  fhir:Resource.meta [
     fhir:Meta.profile [
       fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/diagnosticreport";
       fhir:index 0;
       fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/diagnosticreport>     ]
  ];
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n            <pre>\nHLA-A,-B,-C genotyping report for John Storm (MRN:12345)\n\nLOCUS   ALLELE 1            ALLELE 2\nHLA-A   HLA-A:01:01G        HLA-A*01:02\nHLA-B   HLA-B*15:01:01G     HLA-B*57:01:01G\nHLA-C   HLA-C*01:02:01G     HLA-C*03:04:01G\n\nAllele assignments based on IMGT/HLA 3.23\nEffective date: 2015-12-15\nMethod: Sequencing of exons 2 and 3 of HLA Class I genes\nLab: aTypingLab Inc\n                    </pre>\n          </div>"
  ];
  fhir:DomainResource.extension [
     fhir:index 0;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/hla-genotyping-resultsAlleleDatabase" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla/" ];
         fhir:Coding.version [ fhir:value "3.23" ]       ]     ]
  ], [
     fhir:index 1;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/hla-genotyping-resultsGlstring" ];
     fhir:Element.extension [
       fhir:index 0;
       fhir:Extension.url [ fhir:value "text" ];
       fhir:Extension.valueString [ fhir:value "HLA-A*01:01:01G+HLA-A*01:02^HLA-B*15:01:01G+HLA-B*57:01:01G^HLA-C*01:02:01G+HLA-C*03:04:01G" ]     ], [
       fhir:index 1;
       fhir:Extension.url [ fhir:value "uri" ];
       fhir:Extension.valueUri [ fhir:value "https://gl.nmdp.org/imgt-hla/3.23.0/multilocus-unphased-genotype/ex" ]     ]
  ];
  fhir:DiagnosticReport.basedOn [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ];
     fhir:Reference.type [ fhir:value "ServiceRequest" ];
     fhir:Reference.display [ fhir:value "Class I HLA genotyping for John Storm" ]
  ];
  fhir:DiagnosticReport.status [ fhir:value "final"];
  fhir:DiagnosticReport.category [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://hl7.org/fhir/v2/0074" ];
       fhir:Coding.code [ fhir:value "GE" ];
       fhir:Coding.display [ fhir:value "Genetics" ]     ]
  ];
  fhir:DiagnosticReport.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:81247-9;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "81247-9" ];
       fhir:Coding.display [ fhir:value "Master HL7 genetic variant reporting panel" ]     ]
  ];
  fhir:DiagnosticReport.subject [
     fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ];
     fhir:Reference.type [ fhir:value "Patient" ];
     fhir:Reference.display [ fhir:value "John Storm" ]
  ];
  fhir:DiagnosticReport.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:DiagnosticReport.issued [ fhir:value "2016-12-15T14:15:30-06:00"^^xsd:dateTime];
  fhir:DiagnosticReport.performer [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ];
     fhir:Reference.type [ fhir:value "Organization" ];
     fhir:Reference.display [ fhir:value "aTypingLab Inc" ]
  ];
  fhir:DiagnosticReport.specimen [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ];
     fhir:Reference.display [ fhir:value "buccal swab from John Storm" ]
  ];
  fhir:DiagnosticReport.result [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228" ];
     fhir:Reference.type [ fhir:value "Observation" ];
     fhir:Reference.display [ fhir:value "HLA-A: HLA-A:01:01:01G+HLA-A*01:02" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70" ];
     fhir:Reference.type [ fhir:value "Observation" ];
     fhir:Reference.display [ fhir:value "HLA-B: HLA-B*15:01:01G+HLA-B*57:01:01G" ]
  ], [
     fhir:index 2;
     fhir:Reference.reference [ fhir:value "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208" ];
     fhir:Reference.type [ fhir:value "Observation" ];
     fhir:Reference.display [ fhir:value "HLA-C: HLA-C*01:02:01G+HLA-C*03:04:01G" ]
  ].

# - ontology header ------------------------------------------------------------

 a owl:Ontology;
  owl:imports fhir:fhir.ttl.