R6 Ballot (3rd Draft)

Publish-box (todo)

Example MolecularDefinition/example-sequence2-2b-concatenated (Turtle)

Clinical Genomics Work GroupMaturity Level: N/AStandards Status: InformativeCompartments: No defined compartments

Raw Turtle (+ also see Turtle/RDF Format Specification)

Simple Sequence example 2 to be concatenated

@prefix fhir: <http://hl7.org/fhir/> .
@prefix owl: <http://www.w3.org/2002/07/owl#> .
@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
@prefix xsd: <http://www.w3.org/2001/XMLSchema#> .

# - resource -------------------------------------------------------------------

<http://hl7.org/fhir/MolecularDefinition/example-sequence2-2b-concatenated> a fhir:MolecularDefinition ;
  fhir:nodeRole fhir:treeRoot ;
  fhir:id [ fhir:v "example-sequence2-2b-concatenated"] ; # 
  fhir:moleculeType [
     fhir:coding ( [
       fhir:system [ fhir:v "http://hl7.org/fhir/sequence-type"^^xsd:anyURI ] ;
       fhir:code [ fhir:v "dna" ] ;
       fhir:display [ fhir:v "DNA Sequence" ]
     ] )
  ] ; # 
  fhir:representation ( [
     fhir:literal [
       fhir:value [ fhir:v "TTTTCAAATCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGTCCTTAAAGAAAC AAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGGAAGAAAATCAAGGAAAGAATGAGTCTAATATCAA GCCTGTACAGACAGTTAATATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGA" ]
     ]
  ] ) . # 

# -------------------------------------------------------------------------------------


Usage note: every effort has been made to ensure that the examples are correct and useful, but they are not a normative part of the specification.