R6 Ballot (3rd Draft)

Publish-box (todo)

Example MolecularDefinition/example-sequence2-2b-concatenated (JSON)

Clinical Genomics Work GroupMaturity Level: N/AStandards Status: InformativeCompartments: No defined compartments

Raw JSON (canonical form + also see JSON Format Specification)

Simple Sequence example 2 to be concatenated

{
  "resourceType" : "MolecularDefinition",
  "id" : "example-sequence2-2b-concatenated",
  "moleculeType" : {
    "coding" : [{
      "system" : "http://hl7.org/fhir/sequence-type",
      "code" : "dna",
      "display" : "DNA Sequence"
    }]
  },
  "representation" : [{
    "literal" : {
      "value" : "TTTTCAAATCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGTCCTTAAAGAAAC AAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGGAAGAAAATCAAGGAAAGAATGAGTCTAATATCAA GCCTGTACAGACAGTTAATATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGA"
    }
  }]
}

Usage note: every effort has been made to ensure that the examples are correct and useful, but they are not a normative part of the specification.