This page is part of the FHIR Specification (v3.5a.0: R4 Ballot 4). The current version which supercedes this version is 5.0.0. For a full list of available versions, see the Directory of published versions
. Page versions: R4 R3
| Orders and Observations Work Group | Maturity Level: N/A | Ballot Status: Informative | Compartments: Device, Encounter, Patient, Practitioner |
Raw Turtle (+ also see Turtle/RDF Format Specification)
An example of a HLA genotyping results report
@prefix fhir: <http://hl7.org/fhir/> .
@prefix loinc: <http://loinc.org/rdf#> .
@prefix owl: <http://www.w3.org/2002/07/owl#> .
@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
@prefix xsd: <http://www.w3.org/2001/XMLSchema#> .
# - resource -------------------------------------------------------------------
<http://hl7.org/fhir/Bundle/hla-1> a fhir:Bundle;
fhir:nodeRole fhir:treeRoot;
fhir:Resource.id [ fhir:value "hla-1"];
fhir:Bundle.type [ fhir:value "transaction"];
fhir:Bundle.entry [
fhir:index 0;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9" ];
fhir:Bundle.entry.resource <urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "DiagnosticReport" ]
]
], [
fhir:index 1;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804" ];
fhir:Bundle.entry.resource <urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
]
], [
fhir:index 2;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675" ];
fhir:Bundle.entry.resource <urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
]
], [
fhir:index 3;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621" ];
fhir:Bundle.entry.resource <urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
]
], [
fhir:index 4;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0" ];
fhir:Bundle.entry.resource <urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
]
], [
fhir:index 5;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670" ];
fhir:Bundle.entry.resource <urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
]
], [
fhir:index 6;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138" ];
fhir:Bundle.entry.resource <urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
]
], [
fhir:index 7;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe" ];
fhir:Bundle.entry.resource <urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
]
], [
fhir:index 8;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309" ];
fhir:Bundle.entry.resource <urn:uuid:db69e549-6267-4777-b4b9-8813f3329309>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
]
], [
fhir:index 9;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0" ];
fhir:Bundle.entry.resource <urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
]
], [
fhir:index 10;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f" ];
fhir:Bundle.entry.resource <urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
]
], [
fhir:index 11;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce" ];
fhir:Bundle.entry.resource <urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
]
], [
fhir:index 12;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9" ];
fhir:Bundle.entry.resource <urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
]
], [
fhir:index 13;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6" ];
fhir:Bundle.entry.resource <urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
]
], [
fhir:index 14;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32" ];
fhir:Bundle.entry.resource <urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
]
], [
fhir:index 15;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228" ];
fhir:Bundle.entry.resource <urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
]
], [
fhir:index 16;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a" ];
fhir:Bundle.entry.resource <urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
]
], [
fhir:index 17;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5" ];
fhir:Bundle.entry.resource <urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
]
], [
fhir:index 18;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70" ];
fhir:Bundle.entry.resource <urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
]
], [
fhir:index 19;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:709c5315-9403-4867-9d82-0b953836665f" ];
fhir:Bundle.entry.resource <urn:uuid:709c5315-9403-4867-9d82-0b953836665f>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
]
], [
fhir:index 20;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47" ];
fhir:Bundle.entry.resource <urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
]
], [
fhir:index 21;
fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208" ];
fhir:Bundle.entry.resource <urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208>;
fhir:Bundle.entry.request [
fhir:Bundle.entry.request.method [ fhir:value "POST" ];
fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
]
] .
<urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9> a fhir:DiagnosticReport;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <h3>HLA-A,-B,-C genotyping report for Mary Chalmers (MRN:12345)</h3>\n <pre>\n LOCUS ALLELE 1 ALLELE 2\n HLA-A HLA-A:01:01G HLA-A*01:02\n HLA-B HLA-B*15:01:01G HLA-B*57:01:01G\n HLA-C HLA-C*01:02:01G HLA-C*03:04:01G\n </pre>\n <p>Allele assignments based on IMGT/HLA 3.23</p>\n <p>Effective date: 2015-12-15</p>\n <p>Method: Sequencing of exons 2 and 3 of HLA Class I genes</p>\n <p>Lab: aTypingLab Inc</p>\n <p>Note: Please refer the <a href=\"genomics.html#hla\">implementation guide </a> for more explanation on this\n carefully organized bundle example.</p>\n <pre>\n Bob Milius - NMDP - 2016-12-01\n\n Transaction bundle that creates and links:\n + DiagnosticReport summarizing genotyping for HLA-A,-B,-C typing of patient(donor)\n + Obervations for each genotype\n + Observations for each allele\n + Sequences for exons 2 and 3 for HLA-A,-B, -C\n\n The endpoints of the following resources are hardcoded into this transaction bundle\n because these are presumed to already exist when developing the DiagnosticRequest\n which was to generate this report bundle:\n\n Patient/119 (potential donor)\n Specimen/120 (buccal swab)\n Organization/68 (typing lab)\n ServiceRequest/123 (report is based on this request)\n </pre>\n </div>"
];
fhir:DomainResource.extension [
fhir:index 0;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-allele-database" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ]
];
fhir:CodeableConcept.text [ fhir:value "IMGT/HLA 3.23" ]
]
], [
fhir:index 1;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-glstring" ];
fhir:Element.extension [
fhir:index 0;
fhir:Extension.url [ fhir:value "text" ];
fhir:Extension.valueString [ fhir:value "HLA-A:01:01G+HLA-A*01:02^HLA-B*15:01:01:01+HLA-B*57:01:01^HLA-C*01:02:01+HLA-C*03:04:01:01" ]
], [
fhir:index 1;
fhir:Extension.url [ fhir:value "uri" ];
fhir:Extension.valueUri [ fhir:value "https://gl.nmdp.org/imgt-hla/3.23.0/multilocus-unphased-genotype/i" ]
]
], [
fhir:index 2;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-method" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ];
fhir:Coding.code [ fhir:value "GTR000000000.0" ]
];
fhir:CodeableConcept.text [ fhir:value "Next Generation Sequencing of exons 2 and 3 of HLA Class I genes" ]
]
];
fhir:DiagnosticReport.basedOn [
fhir:index 0;
fhir:link <http://hl7.org/fhir/ServiceRequest/123>;
fhir:Reference.reference [ fhir:value "ServiceRequest/123" ]
];
fhir:DiagnosticReport.status [ fhir:value "final"];
fhir:DiagnosticReport.category [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ];
fhir:Coding.code [ fhir:value "GE" ];
fhir:Coding.display [ fhir:value "Genetics" ]
]
];
fhir:DiagnosticReport.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:13303-3;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "13303-3" ];
fhir:Coding.display [ fhir:value "HLA-A+B+C (class I) [Type]" ]
]
];
fhir:DiagnosticReport.subject [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:DiagnosticReport.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:DiagnosticReport.issued [ fhir:value "2016-12-15T14:15:30-06:00"^^xsd:dateTime];
fhir:DiagnosticReport.performer [
fhir:index 0;
fhir:link <http://hl7.org/fhir/Organization/68>;
fhir:Reference.reference [ fhir:value "Organization/68" ];
fhir:Reference.display [ fhir:value "aTypingLab Inc" ]
];
fhir:DiagnosticReport.specimen [
fhir:index 0;
fhir:link <http://hl7.org/fhir/Specimen/67>;
fhir:Reference.reference [ fhir:value "Specimen/67" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:DiagnosticReport.result [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228" ];
fhir:Reference.display [ fhir:value "HLA-A: HLA-A:01:01G+HLA-A*01:02" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70" ];
fhir:Reference.display [ fhir:value "HLA-B: HLA-B*15:01:01G+HLA-B*57:01:01G" ]
], [
fhir:index 2;
fhir:Reference.reference [ fhir:value "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208" ];
fhir:Reference.display [ fhir:value "HLA-C: HLA-C*01:02:01G+HLA-C*03:04:01G" ]
] .
<http://hl7.org/fhir/ServiceRequest/123> a fhir:ServiceRequest .
<http://hl7.org/fhir/Patient/119> a fhir:Patient .
<http://hl7.org/fhir/Organization/68> a fhir:Organization .
<http://hl7.org/fhir/Specimen/67> a fhir:Specimen .
<urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804> a fhir:Sequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:01:01:01, exon 2"</pre>\n </div>"
];
fhir:Sequence.type [ fhir:value "dna"];
fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:Sequence.patient [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Sequence.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Sequence.referenceSeq [
fhir:Sequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00001" ]
];
fhir:CodeableConcept.text [ fhir:value "HLA-A*01:01:01:01" ]
];
fhir:Sequence.referenceSeq.windowStart [ fhir:value "503"^^xsd:integer ];
fhir:Sequence.referenceSeq.windowEnd [ fhir:value "773"^^xsd:integer ]
];
fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"] .
<http://hl7.org/fhir/Specimen/120> a fhir:Specimen .
<urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675> a fhir:Sequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:01:01:01, exon 3"</pre>\n </div>"
];
fhir:Sequence.type [ fhir:value "dna"];
fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:Sequence.patient [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Sequence.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Sequence.referenceSeq [
fhir:Sequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00001" ]
];
fhir:CodeableConcept.text [ fhir:value "HLA-A*01:01:01:01" ]
];
fhir:Sequence.referenceSeq.windowStart [ fhir:value "1014"^^xsd:integer ];
fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1290"^^xsd:integer ]
];
fhir:Sequence.observedSeq [ fhir:value "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"] .
<urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621> a fhir:Sequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:02, exon 2"</pre>\n </div>"
];
fhir:Sequence.type [ fhir:value "dna"];
fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:Sequence.patient [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Sequence.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Sequence.referenceSeq [
fhir:Sequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00002" ]
];
fhir:CodeableConcept.text [ fhir:value "HLA-A*01:02" ]
];
fhir:Sequence.referenceSeq.windowStart [ fhir:value "503"^^xsd:integer ];
fhir:Sequence.referenceSeq.windowEnd [ fhir:value "773"^^xsd:integer ]
];
fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTCCACATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"] .
<urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0> a fhir:Sequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:02, exon 3"</pre>\n </div>"
];
fhir:Sequence.type [ fhir:value "dna"];
fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:Sequence.patient [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Sequence.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Sequence.referenceSeq [
fhir:Sequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00002" ]
];
fhir:CodeableConcept.text [ fhir:value "HLA-A*01:02" ]
];
fhir:Sequence.referenceSeq.windowStart [ fhir:value "1014"^^xsd:integer ];
fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1290"^^xsd:integer ]
];
fhir:Sequence.observedSeq [ fhir:value "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"] .
<urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670> a fhir:Sequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*15:01:01:01, exon 2"</pre>\n </div>"
];
fhir:Sequence.type [ fhir:value "dna"];
fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:Sequence.patient [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Sequence.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Sequence.referenceSeq [
fhir:Sequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00162" ]
];
fhir:CodeableConcept.text [ fhir:value "HLA-B*15:01:01:01" ]
];
fhir:Sequence.referenceSeq.windowStart [ fhir:value "486"^^xsd:integer ];
fhir:Sequence.referenceSeq.windowEnd [ fhir:value "756"^^xsd:integer ]
];
fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"] .
<urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138> a fhir:Sequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*15:01:01:01, exon 3"</pre>\n </div>"
];
fhir:Sequence.type [ fhir:value "dna"];
fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:Sequence.patient [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Sequence.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Sequence.referenceSeq [
fhir:Sequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00162" ]
];
fhir:CodeableConcept.text [ fhir:value "HLA-B*15:01:01:01" ]
];
fhir:Sequence.referenceSeq.windowStart [ fhir:value "1001"^^xsd:integer ];
fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1277"^^xsd:integer ]
];
fhir:Sequence.observedSeq [ fhir:value "GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGTGGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"] .
<urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe> a fhir:Sequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*57:01:01, exon 2"</pre>\n </div>"
];
fhir:Sequence.type [ fhir:value "dna"];
fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:Sequence.patient [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Sequence.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Sequence.referenceSeq [
fhir:Sequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00381" ]
];
fhir:CodeableConcept.text [ fhir:value "HLA-B*57:01:01" ]
];
fhir:Sequence.referenceSeq.windowStart [ fhir:value "485"^^xsd:integer ];
fhir:Sequence.referenceSeq.windowEnd [ fhir:value "755"^^xsd:integer ]
];
fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGAAGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG"] .
<urn:uuid:db69e549-6267-4777-b4b9-8813f3329309> a fhir:Sequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*57:01:01, exon 3"</pre>\n </div>"
];
fhir:Sequence.type [ fhir:value "dna"];
fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:Sequence.patient [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Sequence.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Sequence.referenceSeq [
fhir:Sequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00381" ]
];
fhir:CodeableConcept.text [ fhir:value "HLA-B*57:01:01" ]
];
fhir:Sequence.referenceSeq.windowStart [ fhir:value "1001"^^xsd:integer ];
fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1277"^^xsd:integer ]
];
fhir:Sequence.observedSeq [ fhir:value "GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"] .
<urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0> a fhir:Sequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*01:02:01, exon 2"</pre>\n </div>"
];
fhir:Sequence.type [ fhir:value "dna"];
fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:Sequence.patient [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Sequence.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Sequence.referenceSeq [
fhir:Sequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00401" ]
];
fhir:CodeableConcept.text [ fhir:value "HLA-C*01:02:01" ]
];
fhir:Sequence.referenceSeq.windowStart [ fhir:value "486"^^xsd:integer ];
fhir:Sequence.referenceSeq.windowEnd [ fhir:value "756"^^xsd:integer ]
];
fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAAGTATTTCTTCACATCCGTGTCCCGGCCTGGCCGCGGAGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"] .
<urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f> a fhir:Sequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*01:02:01, exon 3"</pre>\n </div>"
];
fhir:Sequence.type [ fhir:value "dna"];
fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:Sequence.patient [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Sequence.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Sequence.referenceSeq [
fhir:Sequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00401" ]
];
fhir:CodeableConcept.text [ fhir:value "HLA-C*01:02:01" ]
];
fhir:Sequence.referenceSeq.windowStart [ fhir:value "1002"^^xsd:integer ];
fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1278"^^xsd:integer ]
];
fhir:Sequence.observedSeq [ fhir:value "GGTCTCACACCCTCCAGTGGATGTGTGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"] .
<urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce> a fhir:Sequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*03:04:01:01, exon 2"</pre>\n </div>"
];
fhir:Sequence.type [ fhir:value "dna"];
fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:Sequence.patient [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Sequence.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Sequence.referenceSeq [
fhir:Sequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00413" ]
];
fhir:CodeableConcept.text [ fhir:value "HLA-C*03:04:01:01" ]
];
fhir:Sequence.referenceSeq.windowStart [ fhir:value "486"^^xsd:integer ];
fhir:Sequence.referenceSeq.windowEnd [ fhir:value "756"^^xsd:integer ]
];
fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"] .
<urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9> a fhir:Sequence;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*03:04:01:01, exon 3"</pre>\n </div>"
];
fhir:Sequence.type [ fhir:value "dna"];
fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
fhir:Sequence.patient [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Sequence.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Sequence.referenceSeq [
fhir:Sequence.referenceSeq.referenceSeqId [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
fhir:Coding.version [ fhir:value "3.23" ];
fhir:Coding.code [ fhir:value "HLA00413" ]
];
fhir:CodeableConcept.text [ fhir:value "HLA-C*03:04:01:01" ]
];
fhir:Sequence.referenceSeq.windowStart [ fhir:value "1001"^^xsd:integer ];
fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1277"^^xsd:integer ]
];
fhir:Sequence.observedSeq [ fhir:value "GGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGG"] .
<urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6> a fhir:Observation;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-A:01:01:01G</pre>\n </div>"
];
fhir:DomainResource.extension [
fhir:index 0;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
fhir:Coding.code [ fhir:value "HGNC:4931" ];
fhir:Coding.display [ fhir:value "HLA-A" ]
]
]
], [
fhir:index 1;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:LA6683-2;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "LA6683-2" ];
fhir:Coding.display [ fhir:value "germline" ]
]
]
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:57290-9;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "57290-9" ];
fhir:Coding.display [ fhir:value "HLA-A [Type] by High resolution" ]
]
];
fhir:Observation.subject [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804" ];
fhir:Reference.display [ fhir:value "HLA-A*01:01:01:01, exon 2" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675" ];
fhir:Reference.display [ fhir:value "HLA-A*01:01:01:01, exon 3" ]
] .
<urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32> a fhir:Observation;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-A*01:02</pre>\n </div>"
];
fhir:DomainResource.extension [
fhir:index 0;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
fhir:Coding.code [ fhir:value "HGNC:4931" ];
fhir:Coding.display [ fhir:value "HLA-A" ]
]
]
], [
fhir:index 1;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:LA6683-2;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "LA6683-2" ];
fhir:Coding.display [ fhir:value "germline" ]
]
]
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:57290-9;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "57290-9" ];
fhir:Coding.display [ fhir:value "HLA-A [Type] by High resolution" ]
]
];
fhir:Observation.subject [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621" ];
fhir:Reference.display [ fhir:value "HLA-A*01:02, exon 2" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0" ];
fhir:Reference.display [ fhir:value "HLA-A*01:02, exon 3" ]
] .
<urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228> a fhir:Observation;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-A:01:01G+HLA-A*01:02</pre>\n </div>"
];
fhir:DomainResource.extension [
fhir:index 0;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
fhir:Coding.code [ fhir:value "HGNC:4931" ];
fhir:Coding.display [ fhir:value "HLA-A" ]
]
]
], [
fhir:index 1;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:LA6683-2;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "LA6683-2" ];
fhir:Coding.display [ fhir:value "germline" ]
]
]
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:57290-9;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "57290-9" ];
fhir:Coding.display [ fhir:value "HLA-A [Type] by High resolution" ]
]
];
fhir:Observation.subject [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6" ];
fhir:Reference.display [ fhir:value "HLA-A*01:01:01G, exons 2 and 3" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32" ];
fhir:Reference.display [ fhir:value "HLA-A*01:02, exons 2 and 3" ]
] .
<urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a> a fhir:Observation;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-B*15:01:01G</pre>\n </div>"
];
fhir:DomainResource.extension [
fhir:index 0;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
fhir:Coding.code [ fhir:value "HGNC:4932" ];
fhir:Coding.display [ fhir:value "HLA-B" ]
]
]
], [
fhir:index 1;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:LA6683-2;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "LA6683-2" ];
fhir:Coding.display [ fhir:value "germline" ]
]
]
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:57291-7;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "57291-7" ];
fhir:Coding.display [ fhir:value "HLA-B [Type] by High resolution" ]
]
];
fhir:Observation.subject [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670" ];
fhir:Reference.display [ fhir:value "HLA-B*15:01:01:01, exon 2" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138" ];
fhir:Reference.display [ fhir:value "HLA-B*15:01:01:01, exon 3" ]
] .
<urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5> a fhir:Observation;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-B*57:01:01G</pre>\n </div>"
];
fhir:DomainResource.extension [
fhir:index 0;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
fhir:Coding.code [ fhir:value "HGNC:4932" ];
fhir:Coding.display [ fhir:value "HLA-B" ]
]
]
], [
fhir:index 1;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:LA6683-2;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "LA6683-2" ];
fhir:Coding.display [ fhir:value "germline" ]
]
]
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:57291-7;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "57291-7" ];
fhir:Coding.display [ fhir:value "HLA-B [Type] by High resolution" ]
]
];
fhir:Observation.subject [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe" ];
fhir:Reference.display [ fhir:value "HLA-B*57:01:01, exon 2" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309" ];
fhir:Reference.display [ fhir:value "HLA-B*57:01:01, exon 3" ]
] .
<urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70> a fhir:Observation;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-B*15:01:01G+HLA-B*57:01:01G</pre>\n </div>"
];
fhir:DomainResource.extension [
fhir:index 0;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
fhir:Coding.code [ fhir:value "HGNC:4932" ];
fhir:Coding.display [ fhir:value "HLA-B" ]
]
]
], [
fhir:index 1;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:LA6683-2;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "LA6683-2" ];
fhir:Coding.display [ fhir:value "germline" ]
]
]
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:57291-7;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "57291-7" ];
fhir:Coding.display [ fhir:value "HLA-B [Type] by High resolution" ]
]
];
fhir:Observation.subject [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a" ];
fhir:Reference.display [ fhir:value "HLA-B*15:01:01G, exons 2 and 3" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5" ];
fhir:Reference.display [ fhir:value "HLA-B*57:01:01G, exons 2 and 3" ]
] .
<urn:uuid:709c5315-9403-4867-9d82-0b953836665f> a fhir:Observation;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-C*01:02:01</pre>\n </div>"
];
fhir:DomainResource.extension [
fhir:index 0;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
fhir:Coding.code [ fhir:value "HGNC:4933" ];
fhir:Coding.display [ fhir:value "HLA-C" ]
]
]
], [
fhir:index 1;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:LA6683-2;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "LA6683-2" ];
fhir:Coding.display [ fhir:value "germline" ]
]
]
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:77636-9;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "77636-9" ];
fhir:Coding.display [ fhir:value "HLA-C [Type] by High resolution" ]
]
];
fhir:Observation.subject [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0" ];
fhir:Reference.display [ fhir:value "HLA-C*01:02:01, exon 2" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f" ];
fhir:Reference.display [ fhir:value "HLA-C*01:02:01, exon 3" ]
] .
<urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47> a fhir:Observation;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-C*03:04:01:01</pre>\n </div>"
];
fhir:DomainResource.extension [
fhir:index 0;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
fhir:Coding.code [ fhir:value "HGNC:4933" ];
fhir:Coding.display [ fhir:value "HLA-C" ]
]
]
], [
fhir:index 1;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:LA6683-2;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "LA6683-2" ];
fhir:Coding.display [ fhir:value "germline" ]
]
]
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:77636-9;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "77636-9" ];
fhir:Coding.display [ fhir:value "HLA-C [Type] by High resolution" ]
]
];
fhir:Observation.subject [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce" ];
fhir:Reference.display [ fhir:value "HLA-C*03:04:01:01, exon 2" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9" ];
fhir:Reference.display [ fhir:value "HLA-C*03:04:01:01, exon 3" ]
] .
<urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208> a fhir:Observation;
fhir:DomainResource.text [
fhir:Narrative.status [ fhir:value "generated" ];
fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-C*01:02:01G+HLA-C*03:04:01G</pre>\n </div>"
];
fhir:DomainResource.extension [
fhir:index 0;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
fhir:Coding.code [ fhir:value "HGNC:4933" ];
fhir:Coding.display [ fhir:value "HLA-C" ]
]
]
], [
fhir:index 1;
fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
fhir:Extension.valueCodeableConcept [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:LA6683-2;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "LA6683-2" ];
fhir:Coding.display [ fhir:value "germline" ]
]
]
];
fhir:Observation.status [ fhir:value "final"];
fhir:Observation.code [
fhir:CodeableConcept.coding [
fhir:index 0;
a loinc:77636-9;
fhir:Coding.system [ fhir:value "http://loinc.org" ];
fhir:Coding.code [ fhir:value "77636-9" ];
fhir:Coding.display [ fhir:value "HLA-C [Type] by High resolution" ]
]
];
fhir:Observation.subject [
fhir:link <http://hl7.org/fhir/Patient/119>;
fhir:Reference.reference [ fhir:value "Patient/119" ];
fhir:Reference.display [ fhir:value "Mary Chalmers" ]
];
fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
fhir:Observation.specimen [
fhir:link <http://hl7.org/fhir/Specimen/120>;
fhir:Reference.reference [ fhir:value "Specimen/120" ];
fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
];
fhir:Observation.derivedFrom [
fhir:index 0;
fhir:Reference.reference [ fhir:value "urn:uuid:709c5315-9403-4867-9d82-0b953836665f" ];
fhir:Reference.display [ fhir:value "HLA-C*01:02:01G, exons 2 and 3" ]
], [
fhir:index 1;
fhir:Reference.reference [ fhir:value "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47" ];
fhir:Reference.display [ fhir:value "HLA-C*03:04:01G, exons 2 and 3" ]
] .
# - ontology header ------------------------------------------------------------
<http://hl7.org/fhir/Bundle/hla-1.ttl> a owl:Ontology;
owl:imports fhir:fhir.ttl;
owl:versionIRI <http://build.fhir.org/Bundle/hla-1.ttl> .
# -------------------------------------------------------------------------------------
Usage note: every effort has been made to ensure that the examples are correct and useful, but they are not a normative part of the specification.