Genomics Reporting Implementation Guide
3.0.0-ballot - Ballot
Genomics Reporting Implementation Guide
3.0.0-ballot - Ballot
This page is part of the Genetic Reporting Implementation Guide (v3.0.0-ballot: STU 3 Ballot 1) based on FHIR (HL7® FHIR® Standard) R4. The current version which supersedes this version is 2.0.0. For a full list of available versions, see the Directory of published versions
@prefix fhir: <http://hl7.org/fhir/> . @prefix loinc: <https://loinc.org/rdf/> . @prefix owl: <http://www.w3.org/2002/07/owl#> . @prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> . @prefix xsd: <http://www.w3.org/2001/XMLSchema#> . # - resource ------------------------------------------------------------------- a fhir:Bundle ; fhir:nodeRole fhir:treeRoot ; fhir:id [ fhir:v "bundle-oncology-report-example"] ; # fhir:type [ fhir:v "transaction"] ; # fhir:entry ( [ fhir:fullUrl [ fhir:v "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "Organization"^^xsd:anyURI ] ; fhir:ifNoneExist [ fhir:v "identifier=http://molit.eu/fhir/genomics/NamingSystem/organization|CEGAT" ] ] ] [ fhir:fullUrl [ fhir:v "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "Patient"^^xsd:anyURI ] ; fhir:ifNoneExist [ fhir:v "identifier=http://molit.eu/fhir/genomics/NamingSystem/cegat/patID|11111" ] ] ] [ fhir:fullUrl [ fhir:v "urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "Specimen"^^xsd:anyURI ] ; fhir:ifNoneExist [ fhir:v "identifier=http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID|UNKNOWN" ] ] ] [ fhir:fullUrl [ fhir:v "urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "Observation"^^xsd:anyURI ] ] ] [ fhir:fullUrl [ fhir:v "urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "Observation"^^xsd:anyURI ] ] ] [ fhir:fullUrl [ fhir:v "urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "Observation"^^xsd:anyURI ] ] ] [ fhir:fullUrl [ fhir:v "urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "Observation"^^xsd:anyURI ] ] ] [ fhir:fullUrl [ fhir:v "urn:uuid:58828523-8893-45fc-973b-16290366c5e5"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:58828523-8893-45fc-973b-16290366c5e5> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "Observation"^^xsd:anyURI ] ] ] [ fhir:fullUrl [ fhir:v "urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "Observation"^^xsd:anyURI ] ] ] [ fhir:fullUrl [ fhir:v "urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "Observation"^^xsd:anyURI ] ] ] [ fhir:fullUrl [ fhir:v "urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "Observation"^^xsd:anyURI ] ] ] [ fhir:fullUrl [ fhir:v "urn:uuid:c3587931-242f-4129-93f9-be24500c8f29"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:c3587931-242f-4129-93f9-be24500c8f29> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "Observation"^^xsd:anyURI ] ] ] [ fhir:fullUrl [ fhir:v "urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "Observation"^^xsd:anyURI ] ] ] [ fhir:fullUrl [ fhir:v "urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "Observation"^^xsd:anyURI ] ] ] [ fhir:fullUrl [ fhir:v "urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "Observation"^^xsd:anyURI ] ] ] [ fhir:fullUrl [ fhir:v "urn:uuid:6a80003f-822d-489e-8286-1f1dcba56dfa"^^xsd:anyURI ] ; ( fhir:resource <urn:uuid:6a80003f-822d-489e-8286-1f1dcba56dfa> ) ; fhir:request [ fhir:method [ fhir:v "POST" ] ; fhir:url [ fhir:v "DiagnosticReport"^^xsd:anyURI ] ] ] ) . # <urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17> a fhir:Organization ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-1"] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: Organization</b><a name=\"Inline-Instance-for-oncology-report-example-1\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Organization "Inline-Instance-for-oncology-report-example-1" </p></div><p><b>identifier</b>: id: CEGAT</p><p><b>name</b>: CEGAT</p></div>" ] ; # fhir:identifier ( [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/organization"^^xsd:anyURI ] ; fhir:value [ fhir:v "CEGAT" ] ] ) ; # fhir:name [ fhir:v "CEGAT"] . # <urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648> a fhir:Patient ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-2"] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: Patient</b><a name=\"Inline-Instance-for-oncology-report-example-2\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Patient "Inline-Instance-for-oncology-report-example-2" </p></div><p><b>identifier</b>: id: 11111</p></div>" ] ; # fhir:identifier ( [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/cegat/patID"^^xsd:anyURI ] ; fhir:value [ fhir:v "11111" ] ] ) . # <urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516> a fhir:Specimen ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-3"] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: Specimen</b><a name=\"Inline-Instance-for-oncology-report-example-3\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Specimen "Inline-Instance-for-oncology-report-example-3" </p></div><p><b>identifier</b>: id: UNKNOWN</p><p><b>type</b>: Tumor <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0487.html\">specimenType</a>#TUMOR)</span></p><p><b>subject</b>: <a href=\"#Patient_Inline-Instance-for-oncology-report-example-2\">See above (urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648)</a></p><h3>Collections</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Method</b></td><td><b>BodySite</b></td></tr><tr><td style=\"display: none\">*</td><td>Biopsy <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> ()</span></td><td>Malignant neoplasm of cardia <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-icd10CM.html\">International Classification of Diseases, 10th Revision, Clinical Modification (ICD-10-CM)</a>#C16.0)</span></td></tr></table></div>" ] ; # fhir:identifier ( [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID"^^xsd:anyURI ] ; fhir:value [ fhir:v "UNKNOWN" ] ] ) ; # fhir:type [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0487"^^xsd:anyURI ] ; fhir:code [ fhir:v "TUMOR" ] ; fhir:display [ fhir:v "Tumor" ] ] ) ] ; # fhir:subject [ fhir:reference [ fhir:v "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; # fhir:collection [ fhir:method [ fhir:text [ fhir:v "Biopsy" ] ] ; fhir:bodySite [ ( fhir:coding [ fhir:system [ fhir:v "http://hl7.org/fhir/sid/icd-10-cm"^^xsd:anyURI ] ; fhir:code [ fhir:v "C16.0" ] ] ) ] ] . # <urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae> a fhir:Observation ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-4"] ; # fhir:meta [ ( fhir:profile [ fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"^^xsd:anyURI ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ) ] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-4\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-4" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: <a href=\"#Patient_Inline-Instance-for-oncology-report-example-2\">See above (urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"#Organization_Inline-Instance-for-oncology-report-example-1\">See above (urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17)</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span>id: UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: PIK3CA <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:8975)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_006218.4:c.3140A>G <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_006218.4:c.3140A>G)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48005-3)</span></p><p><b>value</b>: NP_006209.2:p.His1047Arg <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NP_006209.2:p.His1047Arg)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_006218.4 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_006218.3)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: A</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.2188 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 64 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>" ] ; # fhir:status [ fhir:v "final"] ; # fhir:category ( [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ; fhir:code [ fhir:v "laboratory" ] ] ) ] [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ; fhir:code [ fhir:v "GE" ] ] ) ] ) ; # fhir:code [ ( fhir:coding [ a loinc:69548-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69548-6" ] ; fhir:display [ fhir:v "Genetic variant assessment" ] ] ) ] ; # fhir:subject [ fhir:reference [ fhir:v "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; # fhir:effective [ fhir:v "2023-03-05"^^xsd:date] ; # fhir:performer ( [ fhir:reference [ fhir:v "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ) ; # fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA9633-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA9633-4" ] ; fhir:display [ fhir:v "Present" ] ] ) ] ; # fhir:method [ ( fhir:coding [ a loinc:LA26398-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA26398-0" ] ; fhir:display [ fhir:v "Sequencing" ] ] ) ] ; # fhir:specimen [ fhir:identifier [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID"^^xsd:anyURI ] ; fhir:value [ fhir:v "UNKNOWN" ] ] ] ; # fhir:component ( [ fhir:code [ ( fhir:coding [ a loinc:48002-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48002-0" ] ; fhir:display [ fhir:v "Genomic source class" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA6684-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA6684-0" ] ; fhir:display [ fhir:v "Somatic" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48018-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48018-6" ] ; fhir:display [ fhir:v "Gene studied [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "HGNC:8975" ] ; fhir:display [ fhir:v "PIK3CA" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:62374-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "62374-4" ] ; fhir:display [ fhir:v "Human reference sequence assembly version" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA14029-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA14029-5" ] ; fhir:display [ fhir:v "GRCh37" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48004-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48004-6" ] ; fhir:display [ fhir:v "DNA change (c.HGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_006218.4:c.3140A>G" ] ; fhir:display [ fhir:v "NM_006218.4:c.3140A>G" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48019-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48019-4" ] ; fhir:display [ fhir:v "DNA change type" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://sequenceontology.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "SO:1000002" ] ; fhir:display [ fhir:v "substitution" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48005-3 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48005-3" ] ; fhir:display [ fhir:v "Amino acid change (pHGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NP_006209.2:p.His1047Arg" ] ; fhir:display [ fhir:v "NP_006209.2:p.His1047Arg" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:51958-7 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "51958-7" ] ; fhir:display [ fhir:v "Transcript reference sequence [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/refseq"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_006218.3" ] ; fhir:display [ fhir:v "NM_006218.4" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:69547-8 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69547-8" ] ; fhir:display [ fhir:v "Genomic ref allele [ID]" ] ] ) ] ; fhir:value [ fhir:v "A" ] ] [ fhir:code [ ( fhir:coding [ a loinc:81258-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "81258-6" ] ; fhir:display [ fhir:v "Sample VAF" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "0.2188"^^xsd:decimal ] ; fhir:unit [ fhir:v "relative frequency of a particular allele in the specimen" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] [ fhir:code [ ( fhir:coding [ a loinc:82121-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "82121-5" ] ; fhir:display [ fhir:v "Allelic read depth" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "64"^^xsd:decimal ] ; fhir:unit [ fhir:v "reads per base pair" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] ) . # <urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00> a fhir:Observation ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-5"] ; # fhir:meta [ ( fhir:profile [ fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"^^xsd:anyURI ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ) ] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-5\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-5" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: <a href=\"#Patient_Inline-Instance-for-oncology-report-example-2\">See above (urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"#Organization_Inline-Instance-for-oncology-report-example-1\">See above (urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17)</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span>id: UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: NRAS <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:7989)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_002524.4:c.34G>T <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_002524.4:c.34G>T)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_002524.4 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_002524.4)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.1793 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 145 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>" ] ; # fhir:status [ fhir:v "final"] ; # fhir:category ( [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ; fhir:code [ fhir:v "laboratory" ] ] ) ] [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ; fhir:code [ fhir:v "GE" ] ] ) ] ) ; # fhir:code [ ( fhir:coding [ a loinc:69548-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69548-6" ] ; fhir:display [ fhir:v "Genetic variant assessment" ] ] ) ] ; # fhir:subject [ fhir:reference [ fhir:v "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; # fhir:effective [ fhir:v "2023-03-05"^^xsd:date] ; # fhir:performer ( [ fhir:reference [ fhir:v "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ) ; # fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA9633-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA9633-4" ] ; fhir:display [ fhir:v "Present" ] ] ) ] ; # fhir:method [ ( fhir:coding [ a loinc:LA26398-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA26398-0" ] ; fhir:display [ fhir:v "Sequencing" ] ] ) ] ; # fhir:specimen [ fhir:identifier [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID"^^xsd:anyURI ] ; fhir:value [ fhir:v "UNKNOWN" ] ] ] ; # fhir:component ( [ fhir:code [ ( fhir:coding [ a loinc:48002-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48002-0" ] ; fhir:display [ fhir:v "Genomic source class" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA6684-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA6684-0" ] ; fhir:display [ fhir:v "Somatic" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48018-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48018-6" ] ; fhir:display [ fhir:v "Gene studied [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "HGNC:7989" ] ; fhir:display [ fhir:v "NRAS" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:62374-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "62374-4" ] ; fhir:display [ fhir:v "Human reference sequence assembly version" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA14029-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA14029-5" ] ; fhir:display [ fhir:v "GRCh37" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48004-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48004-6" ] ; fhir:display [ fhir:v "DNA change (c.HGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_002524.4:c.34G>T" ] ; fhir:display [ fhir:v "NM_002524.4:c.34G>T" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48019-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48019-4" ] ; fhir:display [ fhir:v "DNA change type" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://sequenceontology.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "SO:1000002" ] ; fhir:display [ fhir:v "substitution" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:51958-7 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "51958-7" ] ; fhir:display [ fhir:v "Transcript reference sequence [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/refseq"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_002524.4" ] ; fhir:display [ fhir:v "NM_002524.4" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:69547-8 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69547-8" ] ; fhir:display [ fhir:v "Genomic ref allele [ID]" ] ] ) ] ; fhir:value [ fhir:v "C" ] ] [ fhir:code [ ( fhir:coding [ a loinc:81258-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "81258-6" ] ; fhir:display [ fhir:v "Sample VAF" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "0.1793"^^xsd:decimal ] ; fhir:unit [ fhir:v "relative frequency of a particular allele in the specimen" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] [ fhir:code [ ( fhir:coding [ a loinc:82121-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "82121-5" ] ; fhir:display [ fhir:v "Allelic read depth" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "145"^^xsd:decimal ] ; fhir:unit [ fhir:v "reads per base pair" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] ) . # <urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5> a fhir:Observation ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-6"] ; # fhir:meta [ ( fhir:profile [ fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"^^xsd:anyURI ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ) ] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-6\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-6" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: <a href=\"#Patient_Inline-Instance-for-oncology-report-example-2\">See above (urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"#Organization_Inline-Instance-for-oncology-report-example-1\">See above (urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17)</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span>id: UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: FBXW7 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:16712)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_001349798.2:c.1394G>A <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_001349798.2:c.1394G>A)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48005-3)</span></p><p><b>value</b>: NP_001336727.1:p.Arg465His <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NP_001336727.1:p.Arg465His)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_001349798.2 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_001349798.2)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.1053 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 57 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>" ] ; # fhir:status [ fhir:v "final"] ; # fhir:category ( [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ; fhir:code [ fhir:v "laboratory" ] ] ) ] [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ; fhir:code [ fhir:v "GE" ] ] ) ] ) ; # fhir:code [ ( fhir:coding [ a loinc:69548-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69548-6" ] ; fhir:display [ fhir:v "Genetic variant assessment" ] ] ) ] ; # fhir:subject [ fhir:reference [ fhir:v "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; # fhir:effective [ fhir:v "2023-03-05"^^xsd:date] ; # fhir:performer ( [ fhir:reference [ fhir:v "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ) ; # fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA9633-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA9633-4" ] ; fhir:display [ fhir:v "Present" ] ] ) ] ; # fhir:method [ ( fhir:coding [ a loinc:LA26398-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA26398-0" ] ; fhir:display [ fhir:v "Sequencing" ] ] ) ] ; # fhir:specimen [ fhir:identifier [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID"^^xsd:anyURI ] ; fhir:value [ fhir:v "UNKNOWN" ] ] ] ; # fhir:component ( [ fhir:code [ ( fhir:coding [ a loinc:48002-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48002-0" ] ; fhir:display [ fhir:v "Genomic source class" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA6684-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA6684-0" ] ; fhir:display [ fhir:v "Somatic" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48018-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48018-6" ] ; fhir:display [ fhir:v "Gene studied [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "HGNC:16712" ] ; fhir:display [ fhir:v "FBXW7" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:62374-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "62374-4" ] ; fhir:display [ fhir:v "Human reference sequence assembly version" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA14029-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA14029-5" ] ; fhir:display [ fhir:v "GRCh37" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48004-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48004-6" ] ; fhir:display [ fhir:v "DNA change (c.HGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_001349798.2:c.1394G>A" ] ; fhir:display [ fhir:v "NM_001349798.2:c.1394G>A" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48019-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48019-4" ] ; fhir:display [ fhir:v "DNA change type" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://sequenceontology.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "SO:1000002" ] ; fhir:display [ fhir:v "substitution" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48005-3 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48005-3" ] ; fhir:display [ fhir:v "Amino acid change (pHGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NP_001336727.1:p.Arg465His" ] ; fhir:display [ fhir:v "NP_001336727.1:p.Arg465His" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:51958-7 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "51958-7" ] ; fhir:display [ fhir:v "Transcript reference sequence [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/refseq"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_001349798.2" ] ; fhir:display [ fhir:v "NM_001349798.2" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:69547-8 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69547-8" ] ; fhir:display [ fhir:v "Genomic ref allele [ID]" ] ] ) ] ; fhir:value [ fhir:v "C" ] ] [ fhir:code [ ( fhir:coding [ a loinc:81258-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "81258-6" ] ; fhir:display [ fhir:v "Sample VAF" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "0.1053"^^xsd:decimal ] ; fhir:unit [ fhir:v "relative frequency of a particular allele in the specimen" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] [ fhir:code [ ( fhir:coding [ a loinc:82121-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "82121-5" ] ; fhir:display [ fhir:v "Allelic read depth" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "57"^^xsd:decimal ] ; fhir:unit [ fhir:v "reads per base pair" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] ) . # <urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358> a fhir:Observation ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-7"] ; # fhir:meta [ ( fhir:profile [ fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"^^xsd:anyURI ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ) ] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-7\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-7" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: <a href=\"#Patient_Inline-Instance-for-oncology-report-example-2\">See above (urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"#Organization_Inline-Instance-for-oncology-report-example-1\">See above (urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17)</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span>id: UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: KMT2D <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:7133)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_003482.3:c.7900_7901delCA <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_003482.3:c.7900_7901delCA)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: deletion <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:0000159)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_003482.3 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_003482.3)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: CTG</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.188 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 117 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>" ] ; # fhir:status [ fhir:v "final"] ; # fhir:category ( [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ; fhir:code [ fhir:v "laboratory" ] ] ) ] [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ; fhir:code [ fhir:v "GE" ] ] ) ] ) ; # fhir:code [ ( fhir:coding [ a loinc:69548-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69548-6" ] ; fhir:display [ fhir:v "Genetic variant assessment" ] ] ) ] ; # fhir:subject [ fhir:reference [ fhir:v "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; # fhir:effective [ fhir:v "2023-03-05"^^xsd:date] ; # fhir:performer ( [ fhir:reference [ fhir:v "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ) ; # fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA9633-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA9633-4" ] ; fhir:display [ fhir:v "Present" ] ] ) ] ; # fhir:method [ ( fhir:coding [ a loinc:LA26398-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA26398-0" ] ; fhir:display [ fhir:v "Sequencing" ] ] ) ] ; # fhir:specimen [ fhir:identifier [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID"^^xsd:anyURI ] ; fhir:value [ fhir:v "UNKNOWN" ] ] ] ; # fhir:component ( [ fhir:code [ ( fhir:coding [ a loinc:48002-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48002-0" ] ; fhir:display [ fhir:v "Genomic source class" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA6684-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA6684-0" ] ; fhir:display [ fhir:v "Somatic" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48018-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48018-6" ] ; fhir:display [ fhir:v "Gene studied [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "HGNC:7133" ] ; fhir:display [ fhir:v "KMT2D" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:62374-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "62374-4" ] ; fhir:display [ fhir:v "Human reference sequence assembly version" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA14029-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA14029-5" ] ; fhir:display [ fhir:v "GRCh37" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48004-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48004-6" ] ; fhir:display [ fhir:v "DNA change (c.HGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_003482.3:c.7900_7901delCA" ] ; fhir:display [ fhir:v "NM_003482.3:c.7900_7901delCA" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48019-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48019-4" ] ; fhir:display [ fhir:v "DNA change type" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://sequenceontology.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "SO:0000159" ] ; fhir:display [ fhir:v "deletion" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:51958-7 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "51958-7" ] ; fhir:display [ fhir:v "Transcript reference sequence [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/refseq"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_003482.3" ] ; fhir:display [ fhir:v "NM_003482.3" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:69547-8 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69547-8" ] ; fhir:display [ fhir:v "Genomic ref allele [ID]" ] ] ) ] ; fhir:value [ fhir:v "CTG" ] ] [ fhir:code [ ( fhir:coding [ a loinc:81258-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "81258-6" ] ; fhir:display [ fhir:v "Sample VAF" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "0.188"^^xsd:decimal ] ; fhir:unit [ fhir:v "relative frequency of a particular allele in the specimen" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] [ fhir:code [ ( fhir:coding [ a loinc:82121-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "82121-5" ] ; fhir:display [ fhir:v "Allelic read depth" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "117"^^xsd:decimal ] ; fhir:unit [ fhir:v "reads per base pair" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] ) . # <urn:uuid:58828523-8893-45fc-973b-16290366c5e5> a fhir:Observation ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-8"] ; # fhir:meta [ ( fhir:profile [ fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"^^xsd:anyURI ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ) ] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-8\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-8" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: <a href=\"#Patient_Inline-Instance-for-oncology-report-example-2\">See above (urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"#Organization_Inline-Instance-for-oncology-report-example-1\">See above (urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17)</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span>id: UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: PIK3CA <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:8975)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_006218.3:c.333G>T <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_006218.3:c.333G>T)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_006218.3 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_006218.3)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.1471 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 68 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>" ] ; # fhir:status [ fhir:v "final"] ; # fhir:category ( [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ; fhir:code [ fhir:v "laboratory" ] ] ) ] [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ; fhir:code [ fhir:v "GE" ] ] ) ] ) ; # fhir:code [ ( fhir:coding [ a loinc:69548-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69548-6" ] ; fhir:display [ fhir:v "Genetic variant assessment" ] ] ) ] ; # fhir:subject [ fhir:reference [ fhir:v "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; # fhir:effective [ fhir:v "2023-03-05"^^xsd:date] ; # fhir:performer ( [ fhir:reference [ fhir:v "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ) ; # fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA9633-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA9633-4" ] ; fhir:display [ fhir:v "Present" ] ] ) ] ; # fhir:method [ ( fhir:coding [ a loinc:LA26398-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA26398-0" ] ; fhir:display [ fhir:v "Sequencing" ] ] ) ] ; # fhir:specimen [ fhir:identifier [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID"^^xsd:anyURI ] ; fhir:value [ fhir:v "UNKNOWN" ] ] ] ; # fhir:component ( [ fhir:code [ ( fhir:coding [ a loinc:48002-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48002-0" ] ; fhir:display [ fhir:v "Genomic source class" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA6684-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA6684-0" ] ; fhir:display [ fhir:v "Somatic" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48018-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48018-6" ] ; fhir:display [ fhir:v "Gene studied [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "HGNC:8975" ] ; fhir:display [ fhir:v "PIK3CA" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:62374-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "62374-4" ] ; fhir:display [ fhir:v "Human reference sequence assembly version" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA14029-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA14029-5" ] ; fhir:display [ fhir:v "GRCh37" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48004-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48004-6" ] ; fhir:display [ fhir:v "DNA change (c.HGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_006218.3:c.333G>T" ] ; fhir:display [ fhir:v "NM_006218.3:c.333G>T" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48019-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48019-4" ] ; fhir:display [ fhir:v "DNA change type" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://sequenceontology.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "SO:1000002" ] ; fhir:display [ fhir:v "substitution" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:51958-7 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "51958-7" ] ; fhir:display [ fhir:v "Transcript reference sequence [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/refseq"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_006218.3" ] ; fhir:display [ fhir:v "NM_006218.3" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:69547-8 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69547-8" ] ; fhir:display [ fhir:v "Genomic ref allele [ID]" ] ] ) ] ; fhir:value [ fhir:v "G" ] ] [ fhir:code [ ( fhir:coding [ a loinc:81258-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "81258-6" ] ; fhir:display [ fhir:v "Sample VAF" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "0.1471"^^xsd:decimal ] ; fhir:unit [ fhir:v "relative frequency of a particular allele in the specimen" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] [ fhir:code [ ( fhir:coding [ a loinc:82121-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "82121-5" ] ; fhir:display [ fhir:v "Allelic read depth" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "68"^^xsd:decimal ] ; fhir:unit [ fhir:v "reads per base pair" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] ) . # <urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2> a fhir:Observation ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-9"] ; # fhir:meta [ ( fhir:profile [ fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"^^xsd:anyURI ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ) ] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-9\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-9" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: <a href=\"#Patient_Inline-Instance-for-oncology-report-example-2\">See above (urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"#Organization_Inline-Instance-for-oncology-report-example-1\">See above (urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17)</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span>id: UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: IRS2 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:6126)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_003749.2:c.3960C>T <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_003749.2:c.3960C>T)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_003749.2 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_003749.2)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.1343 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 134 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>" ] ; # fhir:status [ fhir:v "final"] ; # fhir:category ( [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ; fhir:code [ fhir:v "laboratory" ] ] ) ] [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ; fhir:code [ fhir:v "GE" ] ] ) ] ) ; # fhir:code [ ( fhir:coding [ a loinc:69548-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69548-6" ] ; fhir:display [ fhir:v "Genetic variant assessment" ] ] ) ] ; # fhir:subject [ fhir:reference [ fhir:v "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; # fhir:effective [ fhir:v "2023-03-05"^^xsd:date] ; # fhir:performer ( [ fhir:reference [ fhir:v "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ) ; # fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA9633-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA9633-4" ] ; fhir:display [ fhir:v "Present" ] ] ) ] ; # fhir:method [ ( fhir:coding [ a loinc:LA26398-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA26398-0" ] ; fhir:display [ fhir:v "Sequencing" ] ] ) ] ; # fhir:specimen [ fhir:identifier [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID"^^xsd:anyURI ] ; fhir:value [ fhir:v "UNKNOWN" ] ] ] ; # fhir:component ( [ fhir:code [ ( fhir:coding [ a loinc:48002-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48002-0" ] ; fhir:display [ fhir:v "Genomic source class" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA6684-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA6684-0" ] ; fhir:display [ fhir:v "Somatic" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48018-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48018-6" ] ; fhir:display [ fhir:v "Gene studied [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "HGNC:6126" ] ; fhir:display [ fhir:v "IRS2" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:62374-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "62374-4" ] ; fhir:display [ fhir:v "Human reference sequence assembly version" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA14029-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA14029-5" ] ; fhir:display [ fhir:v "GRCh37" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48004-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48004-6" ] ; fhir:display [ fhir:v "DNA change (c.HGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_003749.2:c.3960C>T" ] ; fhir:display [ fhir:v "NM_003749.2:c.3960C>T" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48019-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48019-4" ] ; fhir:display [ fhir:v "DNA change type" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://sequenceontology.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "SO:1000002" ] ; fhir:display [ fhir:v "substitution" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:51958-7 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "51958-7" ] ; fhir:display [ fhir:v "Transcript reference sequence [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/refseq"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_003749.2" ] ; fhir:display [ fhir:v "NM_003749.2" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:69547-8 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69547-8" ] ; fhir:display [ fhir:v "Genomic ref allele [ID]" ] ] ) ] ; fhir:value [ fhir:v "G" ] ] [ fhir:code [ ( fhir:coding [ a loinc:81258-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "81258-6" ] ; fhir:display [ fhir:v "Sample VAF" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "0.1343"^^xsd:decimal ] ; fhir:unit [ fhir:v "relative frequency of a particular allele in the specimen" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] [ fhir:code [ ( fhir:coding [ a loinc:82121-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "82121-5" ] ; fhir:display [ fhir:v "Allelic read depth" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "134"^^xsd:decimal ] ; fhir:unit [ fhir:v "reads per base pair" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] ) . # <urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1> a fhir:Observation ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-10"] ; # fhir:meta [ ( fhir:profile [ fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"^^xsd:anyURI ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ) ] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-10\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-10" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: <a href=\"#Patient_Inline-Instance-for-oncology-report-example-2\">See above (urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"#Organization_Inline-Instance-for-oncology-report-example-1\">See above (urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17)</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span>id: UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: CDKN2A <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:1787)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_000077.4:c.9_32del <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_000077.4:c.9_32del)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: deletion <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:0000159)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48005-3)</span></p><p><b>value</b>: NP_000068.1:p.Ala4_Pro11del <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NP_000068.1:p.Ala4_Pro11del)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_000077.4 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_000077.4)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: AGGCTCCATGCTGCTCCCCGCCGCC</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.0536 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 112 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>" ] ; # fhir:status [ fhir:v "final"] ; # fhir:category ( [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ; fhir:code [ fhir:v "laboratory" ] ] ) ] [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ; fhir:code [ fhir:v "GE" ] ] ) ] ) ; # fhir:code [ ( fhir:coding [ a loinc:69548-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69548-6" ] ; fhir:display [ fhir:v "Genetic variant assessment" ] ] ) ] ; # fhir:subject [ fhir:reference [ fhir:v "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; # fhir:effective [ fhir:v "2023-03-05"^^xsd:date] ; # fhir:performer ( [ fhir:reference [ fhir:v "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ) ; # fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA9633-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA9633-4" ] ; fhir:display [ fhir:v "Present" ] ] ) ] ; # fhir:method [ ( fhir:coding [ a loinc:LA26398-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA26398-0" ] ; fhir:display [ fhir:v "Sequencing" ] ] ) ] ; # fhir:specimen [ fhir:identifier [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID"^^xsd:anyURI ] ; fhir:value [ fhir:v "UNKNOWN" ] ] ] ; # fhir:component ( [ fhir:code [ ( fhir:coding [ a loinc:48002-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48002-0" ] ; fhir:display [ fhir:v "Genomic source class" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA6684-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA6684-0" ] ; fhir:display [ fhir:v "Somatic" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48018-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48018-6" ] ; fhir:display [ fhir:v "Gene studied [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "HGNC:1787" ] ; fhir:display [ fhir:v "CDKN2A" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:62374-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "62374-4" ] ; fhir:display [ fhir:v "Human reference sequence assembly version" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA14029-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA14029-5" ] ; fhir:display [ fhir:v "GRCh37" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48004-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48004-6" ] ; fhir:display [ fhir:v "DNA change (c.HGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_000077.4:c.9_32del" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48019-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48019-4" ] ; fhir:display [ fhir:v "DNA change type" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://sequenceontology.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "SO:0000159" ] ; fhir:display [ fhir:v "deletion" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48005-3 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48005-3" ] ; fhir:display [ fhir:v "Amino acid change (pHGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NP_000068.1:p.Ala4_Pro11del" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:51958-7 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "51958-7" ] ; fhir:display [ fhir:v "Transcript reference sequence [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/refseq"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_000077.4" ] ; fhir:display [ fhir:v "NM_000077.4" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:69547-8 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69547-8" ] ; fhir:display [ fhir:v "Genomic ref allele [ID]" ] ] ) ] ; fhir:value [ fhir:v "AGGCTCCATGCTGCTCCCCGCCGCC" ] ] [ fhir:code [ ( fhir:coding [ a loinc:81258-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "81258-6" ] ; fhir:display [ fhir:v "Sample VAF" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "0.0536"^^xsd:decimal ] ; fhir:unit [ fhir:v "relative frequency of a particular allele in the specimen" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] [ fhir:code [ ( fhir:coding [ a loinc:82121-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "82121-5" ] ; fhir:display [ fhir:v "Allelic read depth" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "112"^^xsd:decimal ] ; fhir:unit [ fhir:v "reads per base pair" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] ) . # <urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf> a fhir:Observation ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-11"] ; # fhir:meta [ ( fhir:profile [ fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"^^xsd:anyURI ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ) ] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-11\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-11" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: <a href=\"#Patient_Inline-Instance-for-oncology-report-example-2\">See above (urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"#Organization_Inline-Instance-for-oncology-report-example-1\">See above (urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17)</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span>id: UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: RECQL4 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:9949)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_004260.4:c.2086C>T <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_004260.4:c.2086C>T)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48005-3)</span></p><p><b>value</b>: NP_004251.4:p.Arg696Cys <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NP_004251.4:p.Arg696Cys)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_004260.4 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_004260.4)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.2568 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 148 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>" ] ; # fhir:status [ fhir:v "final"] ; # fhir:category ( [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ; fhir:code [ fhir:v "laboratory" ] ] ) ] [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ; fhir:code [ fhir:v "GE" ] ] ) ] ) ; # fhir:code [ ( fhir:coding [ a loinc:69548-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69548-6" ] ; fhir:display [ fhir:v "Genetic variant assessment" ] ] ) ] ; # fhir:subject [ fhir:reference [ fhir:v "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; # fhir:effective [ fhir:v "2023-03-05"^^xsd:date] ; # fhir:performer ( [ fhir:reference [ fhir:v "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ) ; # fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA9633-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA9633-4" ] ; fhir:display [ fhir:v "Present" ] ] ) ] ; # fhir:method [ ( fhir:coding [ a loinc:LA26398-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA26398-0" ] ; fhir:display [ fhir:v "Sequencing" ] ] ) ] ; # fhir:specimen [ fhir:identifier [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID"^^xsd:anyURI ] ; fhir:value [ fhir:v "UNKNOWN" ] ] ] ; # fhir:component ( [ fhir:code [ ( fhir:coding [ a loinc:48002-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48002-0" ] ; fhir:display [ fhir:v "Genomic source class" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA6684-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA6684-0" ] ; fhir:display [ fhir:v "Somatic" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48018-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48018-6" ] ; fhir:display [ fhir:v "Gene studied [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "HGNC:9949" ] ; fhir:display [ fhir:v "RECQL4" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:62374-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "62374-4" ] ; fhir:display [ fhir:v "Human reference sequence assembly version" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA14029-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA14029-5" ] ; fhir:display [ fhir:v "GRCh37" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48004-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48004-6" ] ; fhir:display [ fhir:v "DNA change (c.HGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_004260.4:c.2086C>T" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48019-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48019-4" ] ; fhir:display [ fhir:v "DNA change type" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://sequenceontology.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "SO:1000002" ] ; fhir:display [ fhir:v "substitution" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48005-3 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48005-3" ] ; fhir:display [ fhir:v "Amino acid change (pHGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NP_004251.4:p.Arg696Cys" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:51958-7 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "51958-7" ] ; fhir:display [ fhir:v "Transcript reference sequence [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/refseq"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_004260.4" ] ; fhir:display [ fhir:v "NM_004260.4" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:69547-8 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69547-8" ] ; fhir:display [ fhir:v "Genomic ref allele [ID]" ] ] ) ] ; fhir:value [ fhir:v "G" ] ] [ fhir:code [ ( fhir:coding [ a loinc:81258-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "81258-6" ] ; fhir:display [ fhir:v "Sample VAF" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "0.2568"^^xsd:decimal ] ; fhir:unit [ fhir:v "relative frequency of a particular allele in the specimen" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] [ fhir:code [ ( fhir:coding [ a loinc:82121-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "82121-5" ] ; fhir:display [ fhir:v "Allelic read depth" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "148"^^xsd:decimal ] ; fhir:unit [ fhir:v "reads per base pair" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] ) . # <urn:uuid:c3587931-242f-4129-93f9-be24500c8f29> a fhir:Observation ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-12"] ; # fhir:meta [ ( fhir:profile [ fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"^^xsd:anyURI ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ) ] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-12\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-12" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: <a href=\"#Patient_Inline-Instance-for-oncology-report-example-2\">See above (urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"#Organization_Inline-Instance-for-oncology-report-example-1\">See above (urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17)</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span>id: UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: RYR1 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:10483)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_000540.3:c.4964G>A <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_000540.3:c.4964G>A)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48005-3)</span></p><p><b>value</b>: NP_000531.2:p.Arg1655Leu <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NP_000531.2:p.Arg1655Leu)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_000540.3 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_000540.2)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.2151 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 93 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>" ] ; # fhir:status [ fhir:v "final"] ; # fhir:category ( [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ; fhir:code [ fhir:v "laboratory" ] ] ) ] [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ; fhir:code [ fhir:v "GE" ] ] ) ] ) ; # fhir:code [ ( fhir:coding [ a loinc:69548-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69548-6" ] ; fhir:display [ fhir:v "Genetic variant assessment" ] ] ) ] ; # fhir:subject [ fhir:reference [ fhir:v "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; # fhir:effective [ fhir:v "2023-03-05"^^xsd:date] ; # fhir:performer ( [ fhir:reference [ fhir:v "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ) ; # fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA9633-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA9633-4" ] ; fhir:display [ fhir:v "Present" ] ] ) ] ; # fhir:method [ ( fhir:coding [ a loinc:LA26398-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA26398-0" ] ; fhir:display [ fhir:v "Sequencing" ] ] ) ] ; # fhir:specimen [ fhir:identifier [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID"^^xsd:anyURI ] ; fhir:value [ fhir:v "UNKNOWN" ] ] ] ; # fhir:component ( [ fhir:code [ ( fhir:coding [ a loinc:48002-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48002-0" ] ; fhir:display [ fhir:v "Genomic source class" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA6684-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA6684-0" ] ; fhir:display [ fhir:v "Somatic" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48018-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48018-6" ] ; fhir:display [ fhir:v "Gene studied [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "HGNC:10483" ] ; fhir:display [ fhir:v "RYR1" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:62374-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "62374-4" ] ; fhir:display [ fhir:v "Human reference sequence assembly version" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA14029-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA14029-5" ] ; fhir:display [ fhir:v "GRCh37" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48004-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48004-6" ] ; fhir:display [ fhir:v "DNA change (c.HGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_000540.3:c.4964G>A" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48019-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48019-4" ] ; fhir:display [ fhir:v "DNA change type" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://sequenceontology.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "SO:1000002" ] ; fhir:display [ fhir:v "substitution" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48005-3 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48005-3" ] ; fhir:display [ fhir:v "Amino acid change (pHGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NP_000531.2:p.Arg1655Leu" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:51958-7 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "51958-7" ] ; fhir:display [ fhir:v "Transcript reference sequence [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/refseq"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_000540.2" ] ; fhir:display [ fhir:v "NM_000540.3" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:69547-8 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69547-8" ] ; fhir:display [ fhir:v "Genomic ref allele [ID]" ] ] ) ] ; fhir:value [ fhir:v "G" ] ] [ fhir:code [ ( fhir:coding [ a loinc:81258-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "81258-6" ] ; fhir:display [ fhir:v "Sample VAF" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "0.2151"^^xsd:decimal ] ; fhir:unit [ fhir:v "relative frequency of a particular allele in the specimen" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] [ fhir:code [ ( fhir:coding [ a loinc:82121-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "82121-5" ] ; fhir:display [ fhir:v "Allelic read depth" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "93"^^xsd:decimal ] ; fhir:unit [ fhir:v "reads per base pair" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] ) . # <urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6> a fhir:Observation ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-13"] ; # fhir:meta [ ( fhir:profile [ fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"^^xsd:anyURI ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ) ] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-13\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-13" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: <a href=\"#Patient_Inline-Instance-for-oncology-report-example-2\">See above (urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"#Organization_Inline-Instance-for-oncology-report-example-1\">See above (urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17)</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span>id: UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: SACS <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:10519)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_014363.5:c.12118G>A <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_014363.5:c.12118G>A)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_014363.5 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_014363.5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.3333 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 60 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>" ] ; # fhir:status [ fhir:v "final"] ; # fhir:category ( [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ; fhir:code [ fhir:v "laboratory" ] ] ) ] [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ; fhir:code [ fhir:v "GE" ] ] ) ] ) ; # fhir:code [ ( fhir:coding [ a loinc:69548-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69548-6" ] ; fhir:display [ fhir:v "Genetic variant assessment" ] ] ) ] ; # fhir:subject [ fhir:reference [ fhir:v "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; # fhir:effective [ fhir:v "2023-03-05"^^xsd:date] ; # fhir:performer ( [ fhir:reference [ fhir:v "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ) ; # fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA9633-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA9633-4" ] ; fhir:display [ fhir:v "Present" ] ] ) ] ; # fhir:method [ ( fhir:coding [ a loinc:LA26398-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA26398-0" ] ; fhir:display [ fhir:v "Sequencing" ] ] ) ] ; # fhir:specimen [ fhir:identifier [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID"^^xsd:anyURI ] ; fhir:value [ fhir:v "UNKNOWN" ] ] ] ; # fhir:component ( [ fhir:code [ ( fhir:coding [ a loinc:48002-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48002-0" ] ; fhir:display [ fhir:v "Genomic source class" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA6684-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA6684-0" ] ; fhir:display [ fhir:v "Somatic" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48018-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48018-6" ] ; fhir:display [ fhir:v "Gene studied [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "HGNC:10519" ] ; fhir:display [ fhir:v "SACS" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:62374-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "62374-4" ] ; fhir:display [ fhir:v "Human reference sequence assembly version" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA14029-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA14029-5" ] ; fhir:display [ fhir:v "GRCh37" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48004-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48004-6" ] ; fhir:display [ fhir:v "DNA change (c.HGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_014363.5:c.12118G>A" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48019-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48019-4" ] ; fhir:display [ fhir:v "DNA change type" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://sequenceontology.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "SO:1000002" ] ; fhir:display [ fhir:v "substitution" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:51958-7 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "51958-7" ] ; fhir:display [ fhir:v "Transcript reference sequence [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/refseq"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_014363.5" ] ; fhir:display [ fhir:v "NM_014363.5" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:69547-8 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69547-8" ] ; fhir:display [ fhir:v "Genomic ref allele [ID]" ] ] ) ] ; fhir:value [ fhir:v "C" ] ] [ fhir:code [ ( fhir:coding [ a loinc:81258-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "81258-6" ] ; fhir:display [ fhir:v "Sample VAF" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "0.3333"^^xsd:decimal ] ; fhir:unit [ fhir:v "relative frequency of a particular allele in the specimen" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] [ fhir:code [ ( fhir:coding [ a loinc:82121-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "82121-5" ] ; fhir:display [ fhir:v "Allelic read depth" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "60"^^xsd:decimal ] ; fhir:unit [ fhir:v "reads per base pair" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] ) . # <urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2> a fhir:Observation ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-14"] ; # fhir:meta [ ( fhir:profile [ fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"^^xsd:anyURI ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ) ] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-14\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-14" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: <a href=\"#Patient_Inline-Instance-for-oncology-report-example-2\">See above (urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"#Organization_Inline-Instance-for-oncology-report-example-1\">See above (urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17)</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span>id: UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: SLIT2 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:11086)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_004787.3:c.1290C>A <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_004787.3:c.1290C>A)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_004787.3 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_004787.3)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.2642 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 53 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>" ] ; # fhir:status [ fhir:v "final"] ; # fhir:category ( [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ; fhir:code [ fhir:v "laboratory" ] ] ) ] [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ; fhir:code [ fhir:v "GE" ] ] ) ] ) ; # fhir:code [ ( fhir:coding [ a loinc:69548-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69548-6" ] ; fhir:display [ fhir:v "Genetic variant assessment" ] ] ) ] ; # fhir:subject [ fhir:reference [ fhir:v "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; # fhir:effective [ fhir:v "2023-03-05"^^xsd:date] ; # fhir:performer ( [ fhir:reference [ fhir:v "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ) ; # fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA9633-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA9633-4" ] ; fhir:display [ fhir:v "Present" ] ] ) ] ; # fhir:method [ ( fhir:coding [ a loinc:LA26398-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA26398-0" ] ; fhir:display [ fhir:v "Sequencing" ] ] ) ] ; # fhir:specimen [ fhir:identifier [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID"^^xsd:anyURI ] ; fhir:value [ fhir:v "UNKNOWN" ] ] ] ; # fhir:component ( [ fhir:code [ ( fhir:coding [ a loinc:48002-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48002-0" ] ; fhir:display [ fhir:v "Genomic source class" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA6684-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA6684-0" ] ; fhir:display [ fhir:v "Somatic" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48018-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48018-6" ] ; fhir:display [ fhir:v "Gene studied [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "HGNC:11086" ] ; fhir:display [ fhir:v "SLIT2" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:62374-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "62374-4" ] ; fhir:display [ fhir:v "Human reference sequence assembly version" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA14029-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA14029-5" ] ; fhir:display [ fhir:v "GRCh37" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48004-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48004-6" ] ; fhir:display [ fhir:v "DNA change (c.HGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_004787.3:c.1290C>A" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48019-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48019-4" ] ; fhir:display [ fhir:v "DNA change type" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://sequenceontology.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "SO:1000002" ] ; fhir:display [ fhir:v "substitution" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:51958-7 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "51958-7" ] ; fhir:display [ fhir:v "Transcript reference sequence [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/refseq"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_004787.3" ] ; fhir:display [ fhir:v "NM_004787.3" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:69547-8 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69547-8" ] ; fhir:display [ fhir:v "Genomic ref allele [ID]" ] ] ) ] ; fhir:value [ fhir:v "C" ] ] [ fhir:code [ ( fhir:coding [ a loinc:81258-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "81258-6" ] ; fhir:display [ fhir:v "Sample VAF" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "0.2642"^^xsd:decimal ] ; fhir:unit [ fhir:v "relative frequency of a particular allele in the specimen" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] [ fhir:code [ ( fhir:coding [ a loinc:82121-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "82121-5" ] ; fhir:display [ fhir:v "Allelic read depth" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "53"^^xsd:decimal ] ; fhir:unit [ fhir:v "reads per base pair" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] ) . # <urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca> a fhir:Observation ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-15"] ; # fhir:meta [ ( fhir:profile [ fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"^^xsd:anyURI ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ) ] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-15\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-15" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: <a href=\"#Patient_Inline-Instance-for-oncology-report-example-2\">See above (urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"#Organization_Inline-Instance-for-oncology-report-example-1\">See above (urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17)</a></p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span>id: UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: SMARCA4 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:11100)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_003072.5:c.2372C>T <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_003072.5:c.2372C>T)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48005-3)</span></p><p><b>value</b>: NP_003063.2:p.Ala791Val <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NP_003063.2:p.Ala791Val)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_003072.5 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_003072.5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.1938 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 160 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>" ] ; # fhir:status [ fhir:v "final"] ; # fhir:category ( [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ; fhir:code [ fhir:v "laboratory" ] ] ) ] [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ; fhir:code [ fhir:v "GE" ] ] ) ] ) ; # fhir:code [ ( fhir:coding [ a loinc:69548-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69548-6" ] ; fhir:display [ fhir:v "Genetic variant assessment" ] ] ) ] ; # fhir:subject [ fhir:reference [ fhir:v "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; # fhir:effective [ fhir:v "2023-03-05"^^xsd:date] ; # fhir:performer ( [ fhir:reference [ fhir:v "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ) ; # fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA9633-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA9633-4" ] ; fhir:display [ fhir:v "Present" ] ] ) ] ; # fhir:method [ ( fhir:coding [ a loinc:LA26398-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA26398-0" ] ; fhir:display [ fhir:v "Sequencing" ] ] ) ] ; # fhir:specimen [ fhir:identifier [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID"^^xsd:anyURI ] ; fhir:value [ fhir:v "UNKNOWN" ] ] ] ; # fhir:component ( [ fhir:code [ ( fhir:coding [ a loinc:48002-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48002-0" ] ; fhir:display [ fhir:v "Genomic source class" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA6684-0 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA6684-0" ] ; fhir:display [ fhir:v "Somatic" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48018-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48018-6" ] ; fhir:display [ fhir:v "Gene studied [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "HGNC:11100" ] ; fhir:display [ fhir:v "SMARCA4" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:62374-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "62374-4" ] ; fhir:display [ fhir:v "Human reference sequence assembly version" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ a loinc:LA14029-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "LA14029-5" ] ; fhir:display [ fhir:v "GRCh37" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48004-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48004-6" ] ; fhir:display [ fhir:v "DNA change (c.HGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_003072.5:c.2372C>T" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48019-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48019-4" ] ; fhir:display [ fhir:v "DNA change type" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://sequenceontology.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "SO:1000002" ] ; fhir:display [ fhir:v "substitution" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:48005-3 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "48005-3" ] ; fhir:display [ fhir:v "Amino acid change (pHGVS)" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://varnomen.hgvs.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "NP_003063.2:p.Ala791Val" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:51958-7 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "51958-7" ] ; fhir:display [ fhir:v "Transcript reference sequence [ID]" ] ] ) ] ; fhir:value [ a fhir:CodeableConcept ; ( fhir:coding [ fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/refseq"^^xsd:anyURI ] ; fhir:code [ fhir:v "NM_003072.5" ] ; fhir:display [ fhir:v "NM_003072.5" ] ] ) ] ] [ fhir:code [ ( fhir:coding [ a loinc:69547-8 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "69547-8" ] ; fhir:display [ fhir:v "Genomic ref allele [ID]" ] ] ) ] ; fhir:value [ fhir:v "C" ] ] [ fhir:code [ ( fhir:coding [ a loinc:81258-6 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "81258-6" ] ; fhir:display [ fhir:v "Sample VAF" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "0.1938"^^xsd:decimal ] ; fhir:unit [ fhir:v "relative frequency of a particular allele in the specimen" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] [ fhir:code [ ( fhir:coding [ a loinc:82121-5 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "82121-5" ] ; fhir:display [ fhir:v "Allelic read depth" ] ] ) ] ; fhir:value [ a fhir:Quantity ; fhir:value [ fhir:v "160"^^xsd:decimal ] ; fhir:unit [ fhir:v "reads per base pair" ] ; fhir:system [ fhir:v "http://unitsofmeasure.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "1" ] ] ] ) . # <urn:uuid:6a80003f-822d-489e-8286-1f1dcba56dfa> a fhir:DiagnosticReport ; fhir:id [ fhir:v "Inline-Instance-for-oncology-report-example-16"] ; # fhir:meta [ ( fhir:profile [ fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genomic-report"^^xsd:anyURI ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genomic-report> ] ) ] ; # fhir:text [ fhir:status [ fhir:v "generated" ] ; fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative: DiagnosticReport</b><a name=\"Inline-Instance-for-oncology-report-example-16\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource DiagnosticReport "Inline-Instance-for-oncology-report-example-16" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-genomic-report.html\">Genomic Report</a></p></div><p><b>identifier</b>: id: 42867</p><p><b>status</b>: final</p><p><b>category</b>: Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic analysis report <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51969-4)</span></p><p><b>subject</b>: <a href=\"#Patient_Inline-Instance-for-oncology-report-example-2\">See above (urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648)</a></p><p><b>issued</b>: Sep 15, 2019, 3:35:05 PM</p><p><b>performer</b>: <a href=\"#Organization_Inline-Instance-for-oncology-report-example-1\">See above (urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17)</a></p><p><b>specimen</b>: <a href=\"#Specimen_Inline-Instance-for-oncology-report-example-3\">See above (urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516)</a></p><p><b>result</b>: </p><ul><li><a href=\"#Observation_Inline-Instance-for-oncology-report-example-4\">See above (urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae)</a></li><li><a href=\"#Observation_Inline-Instance-for-oncology-report-example-5\">See above (urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00)</a></li><li><a href=\"#Observation_Inline-Instance-for-oncology-report-example-6\">See above (urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5)</a></li><li><a href=\"#Observation_Inline-Instance-for-oncology-report-example-7\">See above (urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358)</a></li><li><a href=\"#Observation_Inline-Instance-for-oncology-report-example-8\">See above (urn:uuid:58828523-8893-45fc-973b-16290366c5e5)</a></li><li><a href=\"#Observation_Inline-Instance-for-oncology-report-example-9\">See above (urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2)</a></li><li><a href=\"#Observation_Inline-Instance-for-oncology-report-example-10\">See above (urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1)</a></li><li><a href=\"#Observation_Inline-Instance-for-oncology-report-example-11\">See above (urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf)</a></li><li><a href=\"#Observation_Inline-Instance-for-oncology-report-example-12\">See above (urn:uuid:c3587931-242f-4129-93f9-be24500c8f29)</a></li><li><a href=\"#Observation_Inline-Instance-for-oncology-report-example-13\">See above (urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6)</a></li><li><a href=\"#Observation_Inline-Instance-for-oncology-report-example-14\">See above (urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2)</a></li><li><a href=\"#Observation_Inline-Instance-for-oncology-report-example-15\">See above (urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca)</a></li></ul></div>" ] ; # fhir:identifier ( [ fhir:system [ fhir:v "http://molit.eu/fhir/genomics/NamingSystem/cegat/reportID"^^xsd:anyURI ] ; fhir:value [ fhir:v "42867" ] ] ) ; # fhir:status [ fhir:v "final"] ; # fhir:category ( [ ( fhir:coding [ fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ; fhir:code [ fhir:v "GE" ] ] ) ] ) ; # fhir:code [ ( fhir:coding [ a loinc:51969-4 ; fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ; fhir:code [ fhir:v "51969-4" ] ; fhir:display [ fhir:v "Genetic analysis report" ] ] ) ] ; # fhir:subject [ fhir:reference [ fhir:v "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; # fhir:issued [ fhir:v "2019-09-15T11:35:05.722-04:00"^^xsd:dateTime] ; # fhir:performer ( [ fhir:reference [ fhir:v "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ) ; # fhir:specimen ( [ fhir:reference [ fhir:v "urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516" ] ] ) ; # fhir:result ( [ fhir:reference [ fhir:v "urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae" ] ] [ fhir:reference [ fhir:v "urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00" ] ] [ fhir:reference [ fhir:v "urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5" ] ] [ fhir:reference [ fhir:v "urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358" ] ] [ fhir:reference [ fhir:v "urn:uuid:58828523-8893-45fc-973b-16290366c5e5" ] ] [ fhir:reference [ fhir:v "urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2" ] ] [ fhir:reference [ fhir:v "urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1" ] ] [ fhir:reference [ fhir:v "urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf" ] ] [ fhir:reference [ fhir:v "urn:uuid:c3587931-242f-4129-93f9-be24500c8f29" ] ] [ fhir:reference [ fhir:v "urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6" ] ] [ fhir:reference [ fhir:v "urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2" ] ] [ fhir:reference [ fhir:v "urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca" ] ] ) . #
IG © 2022+ HL7 International / Clinical Genomics. Package hl7.fhir.uv.genomics-reporting#3.0.0-ballot based on FHIR 4.0.1. Generated 2023-12-18
Links: Table of Contents |
QA Report
| Version History |
|
Propose a change