Release 4
DiagnosticsThis page is part of the FHIR Specification (v4.0.1: R4 - Mixed Normative and STU) in it's permanent home (it will always be available at this URL). The current version which supercedes this version is 5.0.0. For a full list of available versions, see the Directory of published versions 
. Page versions: R4 R3
| Orders and Observations Work Group | Maturity Level: N/A | Standards Status: Informative | Compartments: Device, Encounter, Patient, Practitioner |
Raw JSON (canonical form + also see JSON Format Specification)
An example of a HLA genotyping results report
{
"resourceType": "Bundle",
"id": "hla-1",
"type": "transaction",
"entry": [
{
"fullUrl": "urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9",
"resource": {
"resourceType": "DiagnosticReport",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<h3>HLA-A,-B,-C genotyping report for Mary Chalmers (MRN:12345)</h3>\n\t\t\t\t\t\t<pre>\n LOCUS ALLELE 1 ALLELE 2\n HLA-A HLA-A:01:01G HLA-A*01:02\n HLA-B HLA-B*15:01:01G HLA-B*57:01:01G\n HLA-C HLA-C*01:02:01G HLA-C*03:04:01G\n </pre>\n\t\t\t\t\t\t<p>Allele assignments based on IMGT/HLA 3.23</p>\n\t\t\t\t\t\t<p>Effective date: 2015-12-15</p>\n\t\t\t\t\t\t<p>Method: Sequencing of exons 2 and 3 of HLA Class I genes</p>\n\t\t\t\t\t\t<p>Lab: aTypingLab Inc</p>\n\t\t\t\t\t\t<p>Note: Please refer the <a href=\"genomics.html#hla\">implementation guide </a> for more explanation on this\n carefully organized bundle example.</p>\n\t\t\t\t\t\t<pre>\n Bob Milius - NMDP - 2016-12-01\n\n Transaction bundle that creates and links:\n + DiagnosticReport summarizing genotyping for HLA-A,-B,-C typing of patient(donor)\n + Obervations for each genotype\n + Observations for each allele\n + Sequences for exons 2 and 3 for HLA-A,-B, -C\n\n The endpoints of the following resources are hardcoded into this transaction bundle\n because these are presumed to already exist when developing the DiagnosticRequest\n which was to generate this report bundle:\n\n Patient/119 (potential donor)\n Specimen/120 (buccal swab)\n Organization/68 (typing lab)\n ServiceRequest/123 (report is based on this request)\n </pre>\n\t\t\t\t\t</div>"
},
"extension": [
{
"url": "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-allele-database",
"valueCodeableConcept": {
"coding": [
{
"system": "http://www.ebi.ac.uk/ipd/imgt/hla",
"version": "3.23"
}
],
"text": "IMGT/HLA 3.23"
}
},
{
"url": "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-glstring",
"extension": [
{
"url": "text",
"valueString": "HLA-A:01:01G+HLA-A*01:02^HLA-B*15:01:01:01+HLA-B*57:01:01^HLA-C*01:02:01+HLA-C*03:04:01:01"
},
{
"url": "uri",
"valueUri": "https://gl.nmdp.org/imgt-hla/3.23.0/multilocus-unphased-genotype/i"
}
]
},
{
"url": "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-method",
"valueCodeableConcept": {
"coding": [
{
"system": "http://www.ncbi.nlm.nih.gov/gtr/",
"code": "GTR000000000.0"
}
],
"text": "Next Generation Sequencing of exons 2 and 3 of HLA Class I genes"
}
}
],
"basedOn": [
{
"reference": "ServiceRequest/123"
}
],
"status": "final",
"category": [
{
"coding": [
{
"system": "http://terminology.hl7.org/CodeSystem/v2-0074",
"code": "GE",
"display": "Genetics"
}
]
}
],
"code": {
"coding": [
{
"system": "http://loinc.org",
"code": "13303-3",
"display": "HLA-A+B+C (class I) [Type]"
}
]
},
"subject": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"effectiveDateTime": "2016-12-15",
"issued": "2016-12-15T14:15:30-06:00",
"performer": [
{
"reference": "Organization/68",
"display": "aTypingLab Inc"
}
],
"specimen": [
{
"reference": "Specimen/67",
"display": "buccal swab from Mary Chalmers"
}
],
"result": [
{
"reference": "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228",
"display": "HLA-A: HLA-A:01:01G+HLA-A*01:02"
},
{
"reference": "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70",
"display": "HLA-B: HLA-B*15:01:01G+HLA-B*57:01:01G"
},
{
"reference": "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208",
"display": "HLA-C: HLA-C*01:02:01G+HLA-C*03:04:01G"
}
]
},
"request": {
"method": "POST",
"url": "DiagnosticReport"
}
},
{
"fullUrl": "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804",
"resource": {
"resourceType": "MolecularSequence",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-A*01:01:01:01, exon 2"</pre>\n\t\t\t\t\t</div>"
},
"type": "dna",
"coordinateSystem": 0,
"patient": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"referenceSeq": {
"referenceSeqId": {
"coding": [
{
"system": "http://www.ebi.ac.uk/ipd/imgt/hla",
"version": "3.23",
"code": "HLA00001"
}
],
"text": "HLA-A*01:01:01:01"
},
"windowStart": 503,
"windowEnd": 773
},
"observedSeq": "GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"
},
"request": {
"method": "POST",
"url": "MolecularSequence"
}
},
{
"fullUrl": "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675",
"resource": {
"resourceType": "MolecularSequence",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-A*01:01:01:01, exon 3"</pre>\n\t\t\t\t\t</div>"
},
"type": "dna",
"coordinateSystem": 0,
"patient": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"referenceSeq": {
"referenceSeqId": {
"coding": [
{
"system": "http://www.ebi.ac.uk/ipd/imgt/hla",
"version": "3.23",
"code": "HLA00001"
}
],
"text": "HLA-A*01:01:01:01"
},
"windowStart": 1014,
"windowEnd": 1290
},
"observedSeq": "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"
},
"request": {
"method": "POST",
"url": "MolecularSequence"
}
},
{
"fullUrl": "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621",
"resource": {
"resourceType": "MolecularSequence",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-A*01:02, exon 2"</pre>\n\t\t\t\t\t</div>"
},
"type": "dna",
"coordinateSystem": 0,
"patient": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"referenceSeq": {
"referenceSeqId": {
"coding": [
{
"system": "http://www.ebi.ac.uk/ipd/imgt/hla",
"version": "3.23",
"code": "HLA00002"
}
],
"text": "HLA-A*01:02"
},
"windowStart": 503,
"windowEnd": 773
},
"observedSeq": "GCTCCCACTCCATGAGGTATTTCTCCACATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"
},
"request": {
"method": "POST",
"url": "MolecularSequence"
}
},
{
"fullUrl": "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0",
"resource": {
"resourceType": "MolecularSequence",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-A*01:02, exon 3"</pre>\n\t\t\t\t\t</div>"
},
"type": "dna",
"coordinateSystem": 0,
"patient": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"referenceSeq": {
"referenceSeqId": {
"coding": [
{
"system": "http://www.ebi.ac.uk/ipd/imgt/hla",
"version": "3.23",
"code": "HLA00002"
}
],
"text": "HLA-A*01:02"
},
"windowStart": 1014,
"windowEnd": 1290
},
"observedSeq": "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"
},
"request": {
"method": "POST",
"url": "MolecularSequence"
}
},
{
"fullUrl": "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670",
"resource": {
"resourceType": "MolecularSequence",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-B*15:01:01:01, exon 2"</pre>\n\t\t\t\t\t</div>"
},
"type": "dna",
"coordinateSystem": 0,
"patient": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"referenceSeq": {
"referenceSeqId": {
"coding": [
{
"system": "http://www.ebi.ac.uk/ipd/imgt/hla",
"version": "3.23",
"code": "HLA00162"
}
],
"text": "HLA-B*15:01:01:01"
},
"windowStart": 486,
"windowEnd": 756
},
"observedSeq": "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"
},
"request": {
"method": "POST",
"url": "MolecularSequence"
}
},
{
"fullUrl": "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138",
"resource": {
"resourceType": "MolecularSequence",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-B*15:01:01:01, exon 3"</pre>\n\t\t\t\t\t</div>"
},
"type": "dna",
"coordinateSystem": 0,
"patient": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"referenceSeq": {
"referenceSeqId": {
"coding": [
{
"system": "http://www.ebi.ac.uk/ipd/imgt/hla",
"version": "3.23",
"code": "HLA00162"
}
],
"text": "HLA-B*15:01:01:01"
},
"windowStart": 1001,
"windowEnd": 1277
},
"observedSeq": "GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGTGGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"
},
"request": {
"method": "POST",
"url": "MolecularSequence"
}
},
{
"fullUrl": "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe",
"resource": {
"resourceType": "MolecularSequence",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-B*57:01:01, exon 2"</pre>\n\t\t\t\t\t</div>"
},
"type": "dna",
"coordinateSystem": 0,
"patient": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"referenceSeq": {
"referenceSeqId": {
"coding": [
{
"system": "http://www.ebi.ac.uk/ipd/imgt/hla",
"version": "3.23",
"code": "HLA00381"
}
],
"text": "HLA-B*57:01:01"
},
"windowStart": 485,
"windowEnd": 755
},
"observedSeq": "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGAAGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG"
},
"request": {
"method": "POST",
"url": "MolecularSequence"
}
},
{
"fullUrl": "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309",
"resource": {
"resourceType": "MolecularSequence",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-B*57:01:01, exon 3"</pre>\n\t\t\t\t\t</div>"
},
"type": "dna",
"coordinateSystem": 0,
"patient": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"referenceSeq": {
"referenceSeqId": {
"coding": [
{
"system": "http://www.ebi.ac.uk/ipd/imgt/hla",
"version": "3.23",
"code": "HLA00381"
}
],
"text": "HLA-B*57:01:01"
},
"windowStart": 1001,
"windowEnd": 1277
},
"observedSeq": "GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"
},
"request": {
"method": "POST",
"url": "MolecularSequence"
}
},
{
"fullUrl": "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0",
"resource": {
"resourceType": "MolecularSequence",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-C*01:02:01, exon 2"</pre>\n\t\t\t\t\t</div>"
},
"type": "dna",
"coordinateSystem": 0,
"patient": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"referenceSeq": {
"referenceSeqId": {
"coding": [
{
"system": "http://www.ebi.ac.uk/ipd/imgt/hla",
"version": "3.23",
"code": "HLA00401"
}
],
"text": "HLA-C*01:02:01"
},
"windowStart": 486,
"windowEnd": 756
},
"observedSeq": "GCTCCCACTCCATGAAGTATTTCTTCACATCCGTGTCCCGGCCTGGCCGCGGAGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"
},
"request": {
"method": "POST",
"url": "MolecularSequence"
}
},
{
"fullUrl": "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f",
"resource": {
"resourceType": "MolecularSequence",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-C*01:02:01, exon 3"</pre>\n\t\t\t\t\t</div>"
},
"type": "dna",
"coordinateSystem": 0,
"patient": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"referenceSeq": {
"referenceSeqId": {
"coding": [
{
"system": "http://www.ebi.ac.uk/ipd/imgt/hla",
"version": "3.23",
"code": "HLA00401"
}
],
"text": "HLA-C*01:02:01"
},
"windowStart": 1002,
"windowEnd": 1278
},
"observedSeq": "GGTCTCACACCCTCCAGTGGATGTGTGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"
},
"request": {
"method": "POST",
"url": "MolecularSequence"
}
},
{
"fullUrl": "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce",
"resource": {
"resourceType": "MolecularSequence",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-C*03:04:01:01, exon 2"</pre>\n\t\t\t\t\t</div>"
},
"type": "dna",
"coordinateSystem": 0,
"patient": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"referenceSeq": {
"referenceSeqId": {
"coding": [
{
"system": "http://www.ebi.ac.uk/ipd/imgt/hla",
"version": "3.23",
"code": "HLA00413"
}
],
"text": "HLA-C*03:04:01:01"
},
"windowStart": 486,
"windowEnd": 756
},
"observedSeq": "GCTCCCACTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"
},
"request": {
"method": "POST",
"url": "MolecularSequence"
}
},
{
"fullUrl": "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9",
"resource": {
"resourceType": "MolecularSequence",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-C*03:04:01:01, exon 3"</pre>\n\t\t\t\t\t</div>"
},
"type": "dna",
"coordinateSystem": 0,
"patient": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"referenceSeq": {
"referenceSeqId": {
"coding": [
{
"system": "http://www.ebi.ac.uk/ipd/imgt/hla",
"version": "3.23",
"code": "HLA00413"
}
],
"text": "HLA-C*03:04:01:01"
},
"windowStart": 1001,
"windowEnd": 1277
},
"observedSeq": "GGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGG"
},
"request": {
"method": "POST",
"url": "MolecularSequence"
}
},
{
"fullUrl": "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6",
"resource": {
"resourceType": "Observation",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-A:01:01:01G</pre>\n\t\t\t\t\t</div>"
},
"extension": [
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
"valueCodeableConcept": {
"coding": [
{
"system": "http://www.genenames.org",
"code": "HGNC:4931",
"display": "HLA-A"
}
]
}
},
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
"valueCodeableConcept": {
"coding": [
{
"system": "http://loinc.org",
"code": "LA6683-2",
"display": "germline"
}
]
}
}
],
"status": "final",
"code": {
"coding": [
{
"system": "http://loinc.org",
"code": "57290-9",
"display": "HLA-A [Type] by High resolution"
}
]
},
"subject": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"effectiveDateTime": "2016-12-15",
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"derivedFrom": [
{
"reference": "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804",
"display": "HLA-A*01:01:01:01, exon 2"
},
{
"reference": "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675",
"display": "HLA-A*01:01:01:01, exon 3"
}
]
},
"request": {
"method": "POST",
"url": "Observation"
}
},
{
"fullUrl": "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32",
"resource": {
"resourceType": "Observation",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-A*01:02</pre>\n\t\t\t\t\t</div>"
},
"extension": [
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
"valueCodeableConcept": {
"coding": [
{
"system": "http://www.genenames.org",
"code": "HGNC:4931",
"display": "HLA-A"
}
]
}
},
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
"valueCodeableConcept": {
"coding": [
{
"system": "http://loinc.org",
"code": "LA6683-2",
"display": "germline"
}
]
}
}
],
"status": "final",
"code": {
"coding": [
{
"system": "http://loinc.org",
"code": "57290-9",
"display": "HLA-A [Type] by High resolution"
}
]
},
"subject": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"effectiveDateTime": "2016-12-15",
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"derivedFrom": [
{
"reference": "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621",
"display": "HLA-A*01:02, exon 2"
},
{
"reference": "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0",
"display": "HLA-A*01:02, exon 3"
}
]
},
"request": {
"method": "POST",
"url": "Observation"
}
},
{
"fullUrl": "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228",
"resource": {
"resourceType": "Observation",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-A:01:01G+HLA-A*01:02</pre>\n\t\t\t\t\t</div>"
},
"extension": [
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
"valueCodeableConcept": {
"coding": [
{
"system": "http://www.genenames.org",
"code": "HGNC:4931",
"display": "HLA-A"
}
]
}
},
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
"valueCodeableConcept": {
"coding": [
{
"system": "http://loinc.org",
"code": "LA6683-2",
"display": "germline"
}
]
}
}
],
"status": "final",
"code": {
"coding": [
{
"system": "http://loinc.org",
"code": "57290-9",
"display": "HLA-A [Type] by High resolution"
}
]
},
"subject": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"effectiveDateTime": "2016-12-15",
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"derivedFrom": [
{
"reference": "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6",
"display": "HLA-A*01:01:01G, exons 2 and 3"
},
{
"reference": "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32",
"display": "HLA-A*01:02, exons 2 and 3"
}
]
},
"request": {
"method": "POST",
"url": "Observation"
}
},
{
"fullUrl": "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a",
"resource": {
"resourceType": "Observation",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-B*15:01:01G</pre>\n\t\t\t\t\t</div>"
},
"extension": [
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
"valueCodeableConcept": {
"coding": [
{
"system": "http://www.genenames.org",
"code": "HGNC:4932",
"display": "HLA-B"
}
]
}
},
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
"valueCodeableConcept": {
"coding": [
{
"system": "http://loinc.org",
"code": "LA6683-2",
"display": "germline"
}
]
}
}
],
"status": "final",
"code": {
"coding": [
{
"system": "http://loinc.org",
"code": "57291-7",
"display": "HLA-B [Type] by High resolution"
}
]
},
"subject": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"effectiveDateTime": "2016-12-15",
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"derivedFrom": [
{
"reference": "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670",
"display": "HLA-B*15:01:01:01, exon 2"
},
{
"reference": "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138",
"display": "HLA-B*15:01:01:01, exon 3"
}
]
},
"request": {
"method": "POST",
"url": "Observation"
}
},
{
"fullUrl": "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5",
"resource": {
"resourceType": "Observation",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-B*57:01:01G</pre>\n\t\t\t\t\t</div>"
},
"extension": [
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
"valueCodeableConcept": {
"coding": [
{
"system": "http://www.genenames.org",
"code": "HGNC:4932",
"display": "HLA-B"
}
]
}
},
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
"valueCodeableConcept": {
"coding": [
{
"system": "http://loinc.org",
"code": "LA6683-2",
"display": "germline"
}
]
}
}
],
"status": "final",
"code": {
"coding": [
{
"system": "http://loinc.org",
"code": "57291-7",
"display": "HLA-B [Type] by High resolution"
}
]
},
"subject": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"effectiveDateTime": "2016-12-15",
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"derivedFrom": [
{
"reference": "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe",
"display": "HLA-B*57:01:01, exon 2"
},
{
"reference": "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309",
"display": "HLA-B*57:01:01, exon 3"
}
]
},
"request": {
"method": "POST",
"url": "Observation"
}
},
{
"fullUrl": "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70",
"resource": {
"resourceType": "Observation",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-B*15:01:01G+HLA-B*57:01:01G</pre>\n\t\t\t\t\t</div>"
},
"extension": [
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
"valueCodeableConcept": {
"coding": [
{
"system": "http://www.genenames.org",
"code": "HGNC:4932",
"display": "HLA-B"
}
]
}
},
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
"valueCodeableConcept": {
"coding": [
{
"system": "http://loinc.org",
"code": "LA6683-2",
"display": "germline"
}
]
}
}
],
"status": "final",
"code": {
"coding": [
{
"system": "http://loinc.org",
"code": "57291-7",
"display": "HLA-B [Type] by High resolution"
}
]
},
"subject": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"effectiveDateTime": "2016-12-15",
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"derivedFrom": [
{
"reference": "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a",
"display": "HLA-B*15:01:01G, exons 2 and 3"
},
{
"reference": "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5",
"display": "HLA-B*57:01:01G, exons 2 and 3"
}
]
},
"request": {
"method": "POST",
"url": "Observation"
}
},
{
"fullUrl": "urn:uuid:709c5315-9403-4867-9d82-0b953836665f",
"resource": {
"resourceType": "Observation",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-C*01:02:01</pre>\n\t\t\t\t\t</div>"
},
"extension": [
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
"valueCodeableConcept": {
"coding": [
{
"system": "http://www.genenames.org",
"code": "HGNC:4933",
"display": "HLA-C"
}
]
}
},
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
"valueCodeableConcept": {
"coding": [
{
"system": "http://loinc.org",
"code": "LA6683-2",
"display": "germline"
}
]
}
}
],
"status": "final",
"code": {
"coding": [
{
"system": "http://loinc.org",
"code": "77636-9",
"display": "HLA-C [Type] by High resolution"
}
]
},
"subject": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"effectiveDateTime": "2016-12-15",
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"derivedFrom": [
{
"reference": "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0",
"display": "HLA-C*01:02:01, exon 2"
},
{
"reference": "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f",
"display": "HLA-C*01:02:01, exon 3"
}
]
},
"request": {
"method": "POST",
"url": "Observation"
}
},
{
"fullUrl": "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47",
"resource": {
"resourceType": "Observation",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-C*03:04:01:01</pre>\n\t\t\t\t\t</div>"
},
"extension": [
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
"valueCodeableConcept": {
"coding": [
{
"system": "http://www.genenames.org",
"code": "HGNC:4933",
"display": "HLA-C"
}
]
}
},
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
"valueCodeableConcept": {
"coding": [
{
"system": "http://loinc.org",
"code": "LA6683-2",
"display": "germline"
}
]
}
}
],
"status": "final",
"code": {
"coding": [
{
"system": "http://loinc.org",
"code": "77636-9",
"display": "HLA-C [Type] by High resolution"
}
]
},
"subject": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"effectiveDateTime": "2016-12-15",
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"derivedFrom": [
{
"reference": "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce",
"display": "HLA-C*03:04:01:01, exon 2"
},
{
"reference": "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9",
"display": "HLA-C*03:04:01:01, exon 3"
}
]
},
"request": {
"method": "POST",
"url": "Observation"
}
},
{
"fullUrl": "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208",
"resource": {
"resourceType": "Observation",
"text": {
"status": "generated",
"div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-C*01:02:01G+HLA-C*03:04:01G</pre>\n\t\t\t\t\t</div>"
},
"extension": [
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
"valueCodeableConcept": {
"coding": [
{
"system": "http://www.genenames.org",
"code": "HGNC:4933",
"display": "HLA-C"
}
]
}
},
{
"url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
"valueCodeableConcept": {
"coding": [
{
"system": "http://loinc.org",
"code": "LA6683-2",
"display": "germline"
}
]
}
}
],
"status": "final",
"code": {
"coding": [
{
"system": "http://loinc.org",
"code": "77636-9",
"display": "HLA-C [Type] by High resolution"
}
]
},
"subject": {
"reference": "Patient/119",
"display": "Mary Chalmers"
},
"effectiveDateTime": "2016-12-15",
"specimen": {
"reference": "Specimen/120",
"display": "buccal swab from Mary Chalmers"
},
"derivedFrom": [
{
"reference": "urn:uuid:709c5315-9403-4867-9d82-0b953836665f",
"display": "HLA-C*01:02:01G, exons 2 and 3"
},
{
"reference": "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47",
"display": "HLA-C*03:04:01G, exons 2 and 3"
}
]
},
"request": {
"method": "POST",
"url": "Observation"
}
}
]
}
Usage note: every effort has been made to ensure that the examples are correct and useful, but they are not a normative part of the specification.
®© HL7.org 2011+. FHIR Release 4 (Technical Correction #1) (v4.0.1) generated on Fri, Nov 1, 2019 09:35+1100. QA Page
Links: Search |
Version History |
Table of Contents |
Credits |
Compare to R3 |
|
Propose a change