This page is part of the FHIR Specification (v4.0.1: R4 - Mixed Normative and STU) in it's permanent home (it will always be available at this URL). The current version which supercedes this version is 5.0.0. For a full list of available versions, see the Directory of published versions  . Page versions: R4 R3
. Page versions: R4 R3
| Orders and Observations Work Group | Maturity Level: N/A | Standards Status: Informative | Compartments: Device, Encounter, Patient, Practitioner | 
Raw JSON (canonical form + also see JSON Format Specification)
An example of a HLA genotyping results report
{
  "resourceType": "Bundle",
  "id": "hla-1",
  "type": "transaction",
  "entry": [
    {
      "fullUrl": "urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9",
      "resource": {
        "resourceType": "DiagnosticReport",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<h3>HLA-A,-B,-C genotyping report for Mary Chalmers (MRN:12345)</h3>\n\t\t\t\t\t\t<pre>\n  LOCUS   ALLELE 1            ALLELE 2\n  HLA-A   HLA-A:01:01G        HLA-A*01:02\n  HLA-B   HLA-B*15:01:01G     HLA-B*57:01:01G\n  HLA-C   HLA-C*01:02:01G     HLA-C*03:04:01G\n                </pre>\n\t\t\t\t\t\t<p>Allele assignments based on IMGT/HLA 3.23</p>\n\t\t\t\t\t\t<p>Effective date: 2015-12-15</p>\n\t\t\t\t\t\t<p>Method: Sequencing of exons 2 and 3 of HLA Class I genes</p>\n\t\t\t\t\t\t<p>Lab: aTypingLab Inc</p>\n\t\t\t\t\t\t<p>Note: Please refer the <a href=\"genomics.html#hla\">implementation guide </a> for more explanation on this\n                carefully organized bundle example.</p>\n\t\t\t\t\t\t<pre>\n  Bob Milius - NMDP - 2016-12-01\n\n  Transaction bundle that creates and links:\n  + DiagnosticReport summarizing genotyping for HLA-A,-B,-C typing of patient(donor)\n  + Obervations for each genotype\n  + Observations for each allele\n  + Sequences for exons 2 and 3 for HLA-A,-B, -C\n\n  The endpoints of the following resources are hardcoded into this transaction bundle\n  because these are presumed to already exist when developing the DiagnosticRequest\n  which was to generate this report bundle:\n\n  Patient/119 (potential donor)\n  Specimen/120 (buccal swab)\n  Organization/68  (typing lab)\n  ServiceRequest/123  (report is based on this request)\n                </pre>\n\t\t\t\t\t</div>"
        },
        "extension": [
          {
            "url": "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-allele-database",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://www.ebi.ac.uk/ipd/imgt/hla",
                  "version": "3.23"
                }
              ],
              "text": "IMGT/HLA 3.23"
            }
          },
          {
            "url": "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-glstring",
            "extension": [
              {
                "url": "text",
                "valueString": "HLA-A:01:01G+HLA-A*01:02^HLA-B*15:01:01:01+HLA-B*57:01:01^HLA-C*01:02:01+HLA-C*03:04:01:01"
              },
              {
                "url": "uri",
                "valueUri": "https://gl.nmdp.org/imgt-hla/3.23.0/multilocus-unphased-genotype/i"
              }
            ]
          },
          {
            "url": "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-method",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://www.ncbi.nlm.nih.gov/gtr/",
                  "code": "GTR000000000.0"
                }
              ],
              "text": "Next Generation Sequencing of exons 2 and 3 of HLA Class I genes"
            }
          }
        ],
        "basedOn": [
          {
            "reference": "ServiceRequest/123"
          }
        ],
        "status": "final",
        "category": [
          {
            "coding": [
              {
                "system": "http://terminology.hl7.org/CodeSystem/v2-0074",
                "code": "GE",
                "display": "Genetics"
              }
            ]
          }
        ],
        "code": {
          "coding": [
            {
              "system": "http://loinc.org",
              "code": "13303-3",
              "display": "HLA-A+B+C (class I) [Type]"
            }
          ]
        },
        "subject": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "effectiveDateTime": "2016-12-15",
        "issued": "2016-12-15T14:15:30-06:00",
        "performer": [
          {
            "reference": "Organization/68",
            "display": "aTypingLab Inc"
          }
        ],
        "specimen": [
          {
            "reference": "Specimen/67",
            "display": "buccal swab from Mary Chalmers"
          }
        ],
        "result": [
          {
            "reference": "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228",
            "display": "HLA-A: HLA-A:01:01G+HLA-A*01:02"
          },
          {
            "reference": "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70",
            "display": "HLA-B: HLA-B*15:01:01G+HLA-B*57:01:01G"
          },
          {
            "reference": "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208",
            "display": "HLA-C: HLA-C*01:02:01G+HLA-C*03:04:01G"
          }
        ]
      },
      "request": {
        "method": "POST",
        "url": "DiagnosticReport"
      }
    },
    {
      "fullUrl": "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804",
      "resource": {
        "resourceType": "MolecularSequence",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-A*01:01:01:01, exon 2"</pre>\n\t\t\t\t\t</div>"
        },
        "type": "dna",
        "coordinateSystem": 0,
        "patient": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "referenceSeq": {
          "referenceSeqId": {
            "coding": [
              {
                "system": "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version": "3.23",
                "code": "HLA00001"
              }
            ],
            "text": "HLA-A*01:01:01:01"
          },
          "windowStart": 503,
          "windowEnd": 773
        },
        "observedSeq": "GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"
      },
      "request": {
        "method": "POST",
        "url": "MolecularSequence"
      }
    },
    {
      "fullUrl": "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675",
      "resource": {
        "resourceType": "MolecularSequence",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-A*01:01:01:01, exon 3"</pre>\n\t\t\t\t\t</div>"
        },
        "type": "dna",
        "coordinateSystem": 0,
        "patient": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "referenceSeq": {
          "referenceSeqId": {
            "coding": [
              {
                "system": "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version": "3.23",
                "code": "HLA00001"
              }
            ],
            "text": "HLA-A*01:01:01:01"
          },
          "windowStart": 1014,
          "windowEnd": 1290
        },
        "observedSeq": "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"
      },
      "request": {
        "method": "POST",
        "url": "MolecularSequence"
      }
    },
    {
      "fullUrl": "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621",
      "resource": {
        "resourceType": "MolecularSequence",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-A*01:02, exon 2"</pre>\n\t\t\t\t\t</div>"
        },
        "type": "dna",
        "coordinateSystem": 0,
        "patient": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "referenceSeq": {
          "referenceSeqId": {
            "coding": [
              {
                "system": "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version": "3.23",
                "code": "HLA00002"
              }
            ],
            "text": "HLA-A*01:02"
          },
          "windowStart": 503,
          "windowEnd": 773
        },
        "observedSeq": "GCTCCCACTCCATGAGGTATTTCTCCACATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"
      },
      "request": {
        "method": "POST",
        "url": "MolecularSequence"
      }
    },
    {
      "fullUrl": "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0",
      "resource": {
        "resourceType": "MolecularSequence",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-A*01:02, exon 3"</pre>\n\t\t\t\t\t</div>"
        },
        "type": "dna",
        "coordinateSystem": 0,
        "patient": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "referenceSeq": {
          "referenceSeqId": {
            "coding": [
              {
                "system": "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version": "3.23",
                "code": "HLA00002"
              }
            ],
            "text": "HLA-A*01:02"
          },
          "windowStart": 1014,
          "windowEnd": 1290
        },
        "observedSeq": "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"
      },
      "request": {
        "method": "POST",
        "url": "MolecularSequence"
      }
    },
    {
      "fullUrl": "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670",
      "resource": {
        "resourceType": "MolecularSequence",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-B*15:01:01:01, exon 2"</pre>\n\t\t\t\t\t</div>"
        },
        "type": "dna",
        "coordinateSystem": 0,
        "patient": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "referenceSeq": {
          "referenceSeqId": {
            "coding": [
              {
                "system": "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version": "3.23",
                "code": "HLA00162"
              }
            ],
            "text": "HLA-B*15:01:01:01"
          },
          "windowStart": 486,
          "windowEnd": 756
        },
        "observedSeq": "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"
      },
      "request": {
        "method": "POST",
        "url": "MolecularSequence"
      }
    },
    {
      "fullUrl": "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138",
      "resource": {
        "resourceType": "MolecularSequence",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-B*15:01:01:01, exon 3"</pre>\n\t\t\t\t\t</div>"
        },
        "type": "dna",
        "coordinateSystem": 0,
        "patient": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "referenceSeq": {
          "referenceSeqId": {
            "coding": [
              {
                "system": "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version": "3.23",
                "code": "HLA00162"
              }
            ],
            "text": "HLA-B*15:01:01:01"
          },
          "windowStart": 1001,
          "windowEnd": 1277
        },
        "observedSeq": "GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGTGGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"
      },
      "request": {
        "method": "POST",
        "url": "MolecularSequence"
      }
    },
    {
      "fullUrl": "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe",
      "resource": {
        "resourceType": "MolecularSequence",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-B*57:01:01, exon 2"</pre>\n\t\t\t\t\t</div>"
        },
        "type": "dna",
        "coordinateSystem": 0,
        "patient": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "referenceSeq": {
          "referenceSeqId": {
            "coding": [
              {
                "system": "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version": "3.23",
                "code": "HLA00381"
              }
            ],
            "text": "HLA-B*57:01:01"
          },
          "windowStart": 485,
          "windowEnd": 755
        },
        "observedSeq": "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGAAGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG"
      },
      "request": {
        "method": "POST",
        "url": "MolecularSequence"
      }
    },
    {
      "fullUrl": "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309",
      "resource": {
        "resourceType": "MolecularSequence",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-B*57:01:01, exon 3"</pre>\n\t\t\t\t\t</div>"
        },
        "type": "dna",
        "coordinateSystem": 0,
        "patient": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "referenceSeq": {
          "referenceSeqId": {
            "coding": [
              {
                "system": "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version": "3.23",
                "code": "HLA00381"
              }
            ],
            "text": "HLA-B*57:01:01"
          },
          "windowStart": 1001,
          "windowEnd": 1277
        },
        "observedSeq": "GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"
      },
      "request": {
        "method": "POST",
        "url": "MolecularSequence"
      }
    },
    {
      "fullUrl": "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0",
      "resource": {
        "resourceType": "MolecularSequence",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-C*01:02:01, exon 2"</pre>\n\t\t\t\t\t</div>"
        },
        "type": "dna",
        "coordinateSystem": 0,
        "patient": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "referenceSeq": {
          "referenceSeqId": {
            "coding": [
              {
                "system": "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version": "3.23",
                "code": "HLA00401"
              }
            ],
            "text": "HLA-C*01:02:01"
          },
          "windowStart": 486,
          "windowEnd": 756
        },
        "observedSeq": "GCTCCCACTCCATGAAGTATTTCTTCACATCCGTGTCCCGGCCTGGCCGCGGAGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"
      },
      "request": {
        "method": "POST",
        "url": "MolecularSequence"
      }
    },
    {
      "fullUrl": "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f",
      "resource": {
        "resourceType": "MolecularSequence",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-C*01:02:01, exon 3"</pre>\n\t\t\t\t\t</div>"
        },
        "type": "dna",
        "coordinateSystem": 0,
        "patient": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "referenceSeq": {
          "referenceSeqId": {
            "coding": [
              {
                "system": "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version": "3.23",
                "code": "HLA00401"
              }
            ],
            "text": "HLA-C*01:02:01"
          },
          "windowStart": 1002,
          "windowEnd": 1278
        },
        "observedSeq": "GGTCTCACACCCTCCAGTGGATGTGTGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"
      },
      "request": {
        "method": "POST",
        "url": "MolecularSequence"
      }
    },
    {
      "fullUrl": "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce",
      "resource": {
        "resourceType": "MolecularSequence",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-C*03:04:01:01, exon 2"</pre>\n\t\t\t\t\t</div>"
        },
        "type": "dna",
        "coordinateSystem": 0,
        "patient": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "referenceSeq": {
          "referenceSeqId": {
            "coding": [
              {
                "system": "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version": "3.23",
                "code": "HLA00413"
              }
            ],
            "text": "HLA-C*03:04:01:01"
          },
          "windowStart": 486,
          "windowEnd": 756
        },
        "observedSeq": "GCTCCCACTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"
      },
      "request": {
        "method": "POST",
        "url": "MolecularSequence"
      }
    },
    {
      "fullUrl": "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9",
      "resource": {
        "resourceType": "MolecularSequence",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>"HLA-C*03:04:01:01, exon 3"</pre>\n\t\t\t\t\t</div>"
        },
        "type": "dna",
        "coordinateSystem": 0,
        "patient": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "referenceSeq": {
          "referenceSeqId": {
            "coding": [
              {
                "system": "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version": "3.23",
                "code": "HLA00413"
              }
            ],
            "text": "HLA-C*03:04:01:01"
          },
          "windowStart": 1001,
          "windowEnd": 1277
        },
        "observedSeq": "GGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGG"
      },
      "request": {
        "method": "POST",
        "url": "MolecularSequence"
      }
    },
    {
      "fullUrl": "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6",
      "resource": {
        "resourceType": "Observation",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-A:01:01:01G</pre>\n\t\t\t\t\t</div>"
        },
        "extension": [
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://www.genenames.org",
                  "code": "HGNC:4931",
                  "display": "HLA-A"
                }
              ]
            }
          },
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://loinc.org",
                  "code": "LA6683-2",
                  "display": "germline"
                }
              ]
            }
          }
        ],
        "status": "final",
        "code": {
          "coding": [
            {
              "system": "http://loinc.org",
              "code": "57290-9",
              "display": "HLA-A [Type] by High resolution"
            }
          ]
        },
        "subject": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "effectiveDateTime": "2016-12-15",
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "derivedFrom": [
          {
            "reference": "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804",
            "display": "HLA-A*01:01:01:01, exon 2"
          },
          {
            "reference": "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675",
            "display": "HLA-A*01:01:01:01, exon 3"
          }
        ]
      },
      "request": {
        "method": "POST",
        "url": "Observation"
      }
    },
    {
      "fullUrl": "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32",
      "resource": {
        "resourceType": "Observation",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-A*01:02</pre>\n\t\t\t\t\t</div>"
        },
        "extension": [
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://www.genenames.org",
                  "code": "HGNC:4931",
                  "display": "HLA-A"
                }
              ]
            }
          },
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://loinc.org",
                  "code": "LA6683-2",
                  "display": "germline"
                }
              ]
            }
          }
        ],
        "status": "final",
        "code": {
          "coding": [
            {
              "system": "http://loinc.org",
              "code": "57290-9",
              "display": "HLA-A [Type] by High resolution"
            }
          ]
        },
        "subject": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "effectiveDateTime": "2016-12-15",
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "derivedFrom": [
          {
            "reference": "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621",
            "display": "HLA-A*01:02, exon 2"
          },
          {
            "reference": "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0",
            "display": "HLA-A*01:02, exon 3"
          }
        ]
      },
      "request": {
        "method": "POST",
        "url": "Observation"
      }
    },
    {
      "fullUrl": "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228",
      "resource": {
        "resourceType": "Observation",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-A:01:01G+HLA-A*01:02</pre>\n\t\t\t\t\t</div>"
        },
        "extension": [
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://www.genenames.org",
                  "code": "HGNC:4931",
                  "display": "HLA-A"
                }
              ]
            }
          },
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://loinc.org",
                  "code": "LA6683-2",
                  "display": "germline"
                }
              ]
            }
          }
        ],
        "status": "final",
        "code": {
          "coding": [
            {
              "system": "http://loinc.org",
              "code": "57290-9",
              "display": "HLA-A [Type] by High resolution"
            }
          ]
        },
        "subject": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "effectiveDateTime": "2016-12-15",
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "derivedFrom": [
          {
            "reference": "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6",
            "display": "HLA-A*01:01:01G, exons 2 and 3"
          },
          {
            "reference": "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32",
            "display": "HLA-A*01:02, exons 2 and 3"
          }
        ]
      },
      "request": {
        "method": "POST",
        "url": "Observation"
      }
    },
    {
      "fullUrl": "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a",
      "resource": {
        "resourceType": "Observation",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-B*15:01:01G</pre>\n\t\t\t\t\t</div>"
        },
        "extension": [
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://www.genenames.org",
                  "code": "HGNC:4932",
                  "display": "HLA-B"
                }
              ]
            }
          },
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://loinc.org",
                  "code": "LA6683-2",
                  "display": "germline"
                }
              ]
            }
          }
        ],
        "status": "final",
        "code": {
          "coding": [
            {
              "system": "http://loinc.org",
              "code": "57291-7",
              "display": "HLA-B [Type] by High resolution"
            }
          ]
        },
        "subject": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "effectiveDateTime": "2016-12-15",
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "derivedFrom": [
          {
            "reference": "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670",
            "display": "HLA-B*15:01:01:01, exon 2"
          },
          {
            "reference": "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138",
            "display": "HLA-B*15:01:01:01, exon 3"
          }
        ]
      },
      "request": {
        "method": "POST",
        "url": "Observation"
      }
    },
    {
      "fullUrl": "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5",
      "resource": {
        "resourceType": "Observation",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-B*57:01:01G</pre>\n\t\t\t\t\t</div>"
        },
        "extension": [
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://www.genenames.org",
                  "code": "HGNC:4932",
                  "display": "HLA-B"
                }
              ]
            }
          },
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://loinc.org",
                  "code": "LA6683-2",
                  "display": "germline"
                }
              ]
            }
          }
        ],
        "status": "final",
        "code": {
          "coding": [
            {
              "system": "http://loinc.org",
              "code": "57291-7",
              "display": "HLA-B [Type] by High resolution"
            }
          ]
        },
        "subject": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "effectiveDateTime": "2016-12-15",
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "derivedFrom": [
          {
            "reference": "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe",
            "display": "HLA-B*57:01:01, exon 2"
          },
          {
            "reference": "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309",
            "display": "HLA-B*57:01:01, exon 3"
          }
        ]
      },
      "request": {
        "method": "POST",
        "url": "Observation"
      }
    },
    {
      "fullUrl": "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70",
      "resource": {
        "resourceType": "Observation",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-B*15:01:01G+HLA-B*57:01:01G</pre>\n\t\t\t\t\t</div>"
        },
        "extension": [
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://www.genenames.org",
                  "code": "HGNC:4932",
                  "display": "HLA-B"
                }
              ]
            }
          },
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://loinc.org",
                  "code": "LA6683-2",
                  "display": "germline"
                }
              ]
            }
          }
        ],
        "status": "final",
        "code": {
          "coding": [
            {
              "system": "http://loinc.org",
              "code": "57291-7",
              "display": "HLA-B [Type] by High resolution"
            }
          ]
        },
        "subject": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "effectiveDateTime": "2016-12-15",
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "derivedFrom": [
          {
            "reference": "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a",
            "display": "HLA-B*15:01:01G, exons 2 and 3"
          },
          {
            "reference": "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5",
            "display": "HLA-B*57:01:01G, exons 2 and 3"
          }
        ]
      },
      "request": {
        "method": "POST",
        "url": "Observation"
      }
    },
    {
      "fullUrl": "urn:uuid:709c5315-9403-4867-9d82-0b953836665f",
      "resource": {
        "resourceType": "Observation",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-C*01:02:01</pre>\n\t\t\t\t\t</div>"
        },
        "extension": [
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://www.genenames.org",
                  "code": "HGNC:4933",
                  "display": "HLA-C"
                }
              ]
            }
          },
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://loinc.org",
                  "code": "LA6683-2",
                  "display": "germline"
                }
              ]
            }
          }
        ],
        "status": "final",
        "code": {
          "coding": [
            {
              "system": "http://loinc.org",
              "code": "77636-9",
              "display": "HLA-C [Type] by High resolution"
            }
          ]
        },
        "subject": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "effectiveDateTime": "2016-12-15",
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "derivedFrom": [
          {
            "reference": "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0",
            "display": "HLA-C*01:02:01, exon 2"
          },
          {
            "reference": "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f",
            "display": "HLA-C*01:02:01, exon 3"
          }
        ]
      },
      "request": {
        "method": "POST",
        "url": "Observation"
      }
    },
    {
      "fullUrl": "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47",
      "resource": {
        "resourceType": "Observation",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-C*03:04:01:01</pre>\n\t\t\t\t\t</div>"
        },
        "extension": [
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://www.genenames.org",
                  "code": "HGNC:4933",
                  "display": "HLA-C"
                }
              ]
            }
          },
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://loinc.org",
                  "code": "LA6683-2",
                  "display": "germline"
                }
              ]
            }
          }
        ],
        "status": "final",
        "code": {
          "coding": [
            {
              "system": "http://loinc.org",
              "code": "77636-9",
              "display": "HLA-C [Type] by High resolution"
            }
          ]
        },
        "subject": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "effectiveDateTime": "2016-12-15",
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "derivedFrom": [
          {
            "reference": "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce",
            "display": "HLA-C*03:04:01:01, exon 2"
          },
          {
            "reference": "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9",
            "display": "HLA-C*03:04:01:01, exon 3"
          }
        ]
      },
      "request": {
        "method": "POST",
        "url": "Observation"
      }
    },
    {
      "fullUrl": "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208",
      "resource": {
        "resourceType": "Observation",
        "text": {
          "status": "generated",
          "div": "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n\t\t\t\t\t\t<pre>HLA-C*01:02:01G+HLA-C*03:04:01G</pre>\n\t\t\t\t\t</div>"
        },
        "extension": [
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://www.genenames.org",
                  "code": "HGNC:4933",
                  "display": "HLA-C"
                }
              ]
            }
          },
          {
            "url": "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass",
            "valueCodeableConcept": {
              "coding": [
                {
                  "system": "http://loinc.org",
                  "code": "LA6683-2",
                  "display": "germline"
                }
              ]
            }
          }
        ],
        "status": "final",
        "code": {
          "coding": [
            {
              "system": "http://loinc.org",
              "code": "77636-9",
              "display": "HLA-C [Type] by High resolution"
            }
          ]
        },
        "subject": {
          "reference": "Patient/119",
          "display": "Mary Chalmers"
        },
        "effectiveDateTime": "2016-12-15",
        "specimen": {
          "reference": "Specimen/120",
          "display": "buccal swab from Mary Chalmers"
        },
        "derivedFrom": [
          {
            "reference": "urn:uuid:709c5315-9403-4867-9d82-0b953836665f",
            "display": "HLA-C*01:02:01G, exons 2 and 3"
          },
          {
            "reference": "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47",
            "display": "HLA-C*03:04:01G, exons 2 and 3"
          }
        ]
      },
      "request": {
        "method": "POST",
        "url": "Observation"
      }
    }
  ]
}
Usage note: every effort has been made to ensure that the examples are correct and useful, but they are not a normative part of the specification.