R6 Ballot (2nd Draft)

Publish-box (todo)

Example MolecularDefinition/example-sequence0-2b-concatenated (JSON)

Clinical Genomics Work GroupMaturity Level: N/AStandards Status: InformativeCompartments: No defined compartments

Raw JSON (canonical form + also see JSON Format Specification)

Simple Sequence example 0 to be concatenated

{
  "resourceType" : "MolecularDefinition",
  "id" : "example-sequence0-2b-concatenated",
  "meta" : {
    "profile" : ["http://hl7.org/fhir/StructureDefinition/sequence"]
  },
  "type" : "dna",
  "representation" : [{
    "literal" : {
      "value" : "ATGAACAGACAAGTAAAAGACATGACAGYGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCTGGTTC TTTTACTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAATCCTAGCCTTCCAAGAGAAGAAAAA GAAGAGAAACTAGAAACAGTTAAAGTGTCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAG"
    }
  }]
}

Usage note: every effort has been made to ensure that the examples are correct and useful, but they are not a normative part of the specification.