R5 Final QA

This page is part of the FHIR Specification (v5.0.0-draft-final: Final QA Preview for R5 - see ballot notes). The current version which supercedes this version is 5.0.0. For a full list of available versions, see the Directory of published versions . Page versions: R5 R4B R4 R3

Example MolecularSequence/sequence-complex-variant (Narrative)

Clinical Genomics Work GroupMaturity Level: N/AStandards Status: InformativeCompartments: Patient

This is the narrative for the resource. See also the XML, JSON or Turtle format. This example conforms to the profile MolecularSequence.

Generated Narrative: MolecularSequence

Resource MolecularSequence "sequence-complex-variant"

identifier: id: ?ngen-9? (use: OFFICIAL)

type: dna

specimen: Specimen/genetics-example1-somatic: Molecular Specimen ID: MLD45-Z4-1234

device: : 12 lead EKG Device Metric

performer: Organization/hl7: HL7 "Health Level Seven International"

relative

coordinateSystem: 0-based interval counting (LOINC#LA30100-4)

StartingSequences

-Sequence[x]WindowStartWindowEndStrand
*NC_000002.12 (nuccore#NC_000002.12)128273724128273754watson

Edits

-StartEndReplacementSequenceReplacedSequence
*128273724128273736CTCATTGTCTCCATTGCATGCGTT

 

 

Usage note: every effort has been made to ensure that the examples are correct and useful, but they are not a normative part of the specification.