Release 5 Preview #2

This page is part of the FHIR Specification (v4.4.0: R5 Preview #2). The current version which supercedes this version is 5.0.0. For a full list of available versions, see the Directory of published versions . Page versions: R5 R4B R4 R3

Sequence-complex-variant

Clinical Genomics Work GroupMaturity Level: N/AStandards Status: InformativeCompartments: Patient

This is the narrative for the resource. See also the XML, JSON or Turtle format. This example conforms to the profile MolecularSequence.

Generated Narrative with Details

id: sequence-complex-variant

identifier: ?ngen-9? (OFFICIAL)

type: dna

coordinateSystem: 1

specimen: Molecular Specimen ID: MLD45-Z4-1234

device: 12 lead EKG Device Metric

performer: HL7

quantity: 25

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000002.12 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000002.12' = 'NC_000002.12)watson128273724128273754

Variants

-StartEndObservedAlleleReferenceAlleleCigar
*128273724128273736CTCATTGTCTCCATTGCATGCGTT3M1D4M6N2M

readCoverage: 1

Repositories

-TypeDatasetIdReadsetId
*otherEnsemblv1beta2

 

 

Usage note: every effort has been made to ensure that the examples are correct and useful, but they are not a normative part of the specification.