R4 Draft for Comment

This page is part of the FHIR Specification (v3.2.0: R4 Ballot 1). The current version which supercedes this version is 5.0.0. For a full list of available versions, see the Directory of published versions . Page versions: R5 R4B R4 R3

Sequence-complex-variant

Clinical Genomics Work GroupMaturity Level: N/ABallot Status: InformativeCompartments: Not linked to any defined compartments

This is the narrative for the resource. See also the XML or JSON format. This example conforms to the profile Sequence.

Generated Narrative with Details

id: sequence-complex-variant

identifier: ?? (OFFICIAL)

type: dna

coordinateSystem: 1

specimen: Molecular Specimen ID: MLD45-Z4-1234

device: 12 lead EKG Device Metric

performer: HL7

quantity: 25

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000002.12 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000002.12' = 'NC_000002.12)1128273724128273754

Variants

-StartEndObservedAlleleReferenceAlleleCigar
*128273724128273736CTCATTGTCTCCATTGCATGCGTT3M1D4M6N2M

readCoverage: 1

Repositories

-TypeDatasetIdReadsetId
*otherEnsemblv1beta2

 

 

Usage note: every effort has been made to ensure that the examples are correct and useful, but they are not a normative part of the specification.