STU3 Candidate

This page is part of the FHIR Specification (v1.8.0: STU 3 Draft). The current version which supercedes this version is 5.0.0. For a full list of available versions, see the Directory of published versions . Page versions: R5 R4B R4 R3

Sequence-complex-variant

This is the narrative for the resource. See also the XML or JSON format. This example conforms to the profile Sequence.

Generated Narrative with Details

id: sequence-complex-variant

type: DNA

coordinateSystem: 1

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000002.12 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000002.12' = 'NC_000002.12)1128273724128273754

Variants

-StartEndObservedAlleleReferenceAlleleCigar
*128273724128273736CTCATTGTCTCCATTGCATGCGTT3M1D4M6N2M

 

 

Usage note: every effort has been made to ensure that the examples are correct and useful, but they are not a normative part of the specification.